EMAIL THIS PAGE TO A FRIEND

BRMS1L

breast cancer metastasis-suppressor 1-like

175 Gene Product Result for
Synonyms: BRMS1
UniProtKB ID: Q5PSV4, A6NFW5, A6NH45, Q9BRI4
Gene ID:
Human(84312) Summary: The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Mouse(52592) breast cancer metastasis-suppressor 1-like
Rat(299053) breast cancer metastasis-suppressor 1-like
domestic guinea pig(100726846) breast cancer metastasis-suppressor 1-like
naked mole-rat(101707701) breast cancer metastasis-suppressor 1-like
sheep(100307034) breast cancer metastasis-suppressor 1-like
chicken(423328) breast cancer metastasis-suppressor 1-like
dog(480292) breast cancer metastasis-suppressor 1-like
domestic cat(101091375) breast cancer metastasis-suppressor 1-like
cow(514432) breast cancer metastasis-suppressor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032352 Rosetta Predictions human pricing
NM_001106731 Rosetta Predictions rat pricing
NM_001037756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359742 predicted 919
2 SASI_Hs01_00070303 predicted 1113
3 SASI_Hs01_00070304 predicted 969
4 SASI_Hs01_00070305 predicted 734
5 SASI_Hs01_00070306 predicted 1027
6 SASI_Hs01_00070307 predicted 973
7 SASI_Hs01_00070308 predicted 887
8 SASI_Hs01_00070309 predicted 896
9 SASI_Hs01_00070310 predicted 645
10 SASI_Hs02_00359743 predicted 985
11 SASI_Hs01_00070311 predicted 1036
12 SASI_Hs01_00070312 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221838 predicted 645
2 SASI_Rn02_00221839 predicted 322
3 SASI_Rn02_00221840 predicted 409
4 SASI_Rn02_00221841 predicted 327
5 SASI_Rn02_00221842 predicted 318
6 SASI_Rn02_00221843 predicted 496
7 SASI_Rn02_00221844 predicted 861
8 SASI_Rn02_00221845 predicted 514
9 SASI_Rn02_00221846 predicted 885
10 SASI_Rn02_00221847 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134040 predicted 741
2 SASI_Mm01_00134041 predicted 1057
3 SASI_Mm01_00134042 predicted 1097
4 SASI_Mm01_00134043 predicted 987
5 SASI_Mm01_00134044 predicted 1041
6 SASI_Mm01_00134046 predicted 432
7 SASI_Mm01_00134047 predicted 361
8 SASI_Mm02_00289415 predicted 531
9 SASI_Mm01_00134048 predicted 524
10 SASI_Mm01_00134049 predicted 1001
11 SASI_Mm01_00134045 predicted 1138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027867
VALIDATED
BRMS1L MISSION shRNA Bacterial Glycerol Stock
breast cancer metastasis-suppressor 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-232s1c1
Sequence:CCGGGACAGTTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-487s1c1
Sequence:CCGGTCTGTGAAGAACAAGTACGAACTCGAGTTCGTACTTGTTCTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-1079s1c1
Sequence:CCGGCCCACATTAGTAAGTCATTAACTCGAGTTAATGACTTACTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027867.2-372s1c1
Sequence:CCGGCCAAGAAGTCATAGCTGGAAACTCGAGTTTCCAGCTATGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-613s1c1
Sequence:CCGGTCGTTGTCTCAGGTCCATATACTCGAGTATATGGACCTGAGACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027867
VALIDATED
BRMS1L MISSION shRNA shRNA Plasmid DNA
breast cancer metastasis-suppressor 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-232s1c1
Sequence:CCGGGACAGTTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-487s1c1
Sequence:CCGGTCTGTGAAGAACAAGTACGAACTCGAGTTCGTACTTGTTCTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-1079s1c1
Sequence:CCGGCCCACATTAGTAAGTCATTAACTCGAGTTAATGACTTACTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027867.2-372s1c1
Sequence:CCGGCCAAGAAGTCATAGCTGGAAACTCGAGTTTCCAGCTATGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-613s1c1
Sequence:CCGGTCGTTGTCTCAGGTCCATATACTCGAGTATATGGACCTGAGACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027867
VALIDATED
BRMS1L MISSION shRNA Lentiviral Transduction Particles
breast cancer metastasis-suppressor 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-232s1c1
Sequence:CCGGGACAGTTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-487s1c1
Sequence:CCGGTCTGTGAAGAACAAGTACGAACTCGAGTTCGTACTTGTTCTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-1079s1c1
Sequence:CCGGCCCACATTAGTAAGTCATTAACTCGAGTTAATGACTTACTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027867.2-372s1c1
Sequence:CCGGCCAAGAAGTCATAGCTGGAAACTCGAGTTTCCAGCTATGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027867.2-613s1c1
Sequence:CCGGTCGTTGTCTCAGGTCCATATACTCGAGTATATGGACCTGAGACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032352
VALIDATED
BRMS1L MISSION shRNA Bacterial Glycerol Stock
breast cancer metastasis-suppressor 1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-230s1c1
Sequence:CCGGGAGGATGGAGATAGCTCAGAACTCGAGTTCTGAGCTATCTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-580s1c1
Sequence:CCGGGAGTGAACTAGAGGAGAAGATCTCGAGATCTTCTCCTCTAGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-139s1c1
Sequence:CCGGGACCAACCATCACGATGAGATCTCGAGATCTCATCGTGATGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-353s1c1
Sequence:CCGGCGATTAAGTCAGGTGGATGCACTCGAGTGCATCCACCTGACTTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1116s1c1
Sequence:CCGGGTTACCAAATGTAAGTGCCATCTCGAGATGGCACTTACATTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-324s1c1
Sequence:CCGGCCGATCTCAAAGATCAACTTTCTCGAGAAAGTTGATCTTTGAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-481s1c1
Sequence:CCGGGCTCTGCTTAGAATCTGTAAACTCGAGTTTACAGATTCTAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-1027s1c1
Sequence:CCGGGCTTTACATTTCACAGCTACACTCGAGTGTAGCTGTGAAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-593s1c1
Sequence:CCGGGAGAAGATAAGAAGGCTTGAACTCGAGTTCAAGCCTTCTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-778s1c1
Sequence:CCGGGACAACAATTAGGAAGGCAATCTCGAGATTGCCTTCCTAATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-239s1c1
Sequence:CCGGGATAGCTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1120s1c1
Sequence:CCGGCCAAATGTAAGTGCCATGAGACTCGAGTCTCATGGCACTTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032352
VALIDATED
BRMS1L MISSION shRNA shRNA Plasmid DNA
breast cancer metastasis-suppressor 1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-230s1c1
Sequence:CCGGGAGGATGGAGATAGCTCAGAACTCGAGTTCTGAGCTATCTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-580s1c1
Sequence:CCGGGAGTGAACTAGAGGAGAAGATCTCGAGATCTTCTCCTCTAGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-139s1c1
Sequence:CCGGGACCAACCATCACGATGAGATCTCGAGATCTCATCGTGATGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-353s1c1
Sequence:CCGGCGATTAAGTCAGGTGGATGCACTCGAGTGCATCCACCTGACTTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1116s1c1
Sequence:CCGGGTTACCAAATGTAAGTGCCATCTCGAGATGGCACTTACATTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-324s1c1
Sequence:CCGGCCGATCTCAAAGATCAACTTTCTCGAGAAAGTTGATCTTTGAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-481s1c1
Sequence:CCGGGCTCTGCTTAGAATCTGTAAACTCGAGTTTACAGATTCTAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-1027s1c1
Sequence:CCGGGCTTTACATTTCACAGCTACACTCGAGTGTAGCTGTGAAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-593s1c1
Sequence:CCGGGAGAAGATAAGAAGGCTTGAACTCGAGTTCAAGCCTTCTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-778s1c1
Sequence:CCGGGACAACAATTAGGAAGGCAATCTCGAGATTGCCTTCCTAATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-239s1c1
Sequence:CCGGGATAGCTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1120s1c1
Sequence:CCGGCCAAATGTAAGTGCCATGAGACTCGAGTCTCATGGCACTTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032352
VALIDATED
BRMS1L MISSION shRNA Lentiviral Transduction Particles
breast cancer metastasis-suppressor 1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-230s1c1
Sequence:CCGGGAGGATGGAGATAGCTCAGAACTCGAGTTCTGAGCTATCTCCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-580s1c1
Sequence:CCGGGAGTGAACTAGAGGAGAAGATCTCGAGATCTTCTCCTCTAGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-139s1c1
Sequence:CCGGGACCAACCATCACGATGAGATCTCGAGATCTCATCGTGATGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032352.2-353s1c1
Sequence:CCGGCGATTAAGTCAGGTGGATGCACTCGAGTGCATCCACCTGACTTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1116s1c1
Sequence:CCGGGTTACCAAATGTAAGTGCCATCTCGAGATGGCACTTACATTTGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-324s1c1
Sequence:CCGGCCGATCTCAAAGATCAACTTTCTCGAGAAAGTTGATCTTTGAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-481s1c1
Sequence:CCGGGCTCTGCTTAGAATCTGTAAACTCGAGTTTACAGATTCTAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-1027s1c1
Sequence:CCGGGCTTTACATTTCACAGCTACACTCGAGTGTAGCTGTGAAATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-593s1c1
Sequence:CCGGGAGAAGATAAGAAGGCTTGAACTCGAGTTCAAGCCTTCTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032352.2-778s1c1
Sequence:CCGGGACAACAATTAGGAAGGCAATCTCGAGATTGCCTTCCTAATTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032352.2-239s1c1
Sequence:CCGGGATAGCTCAGAAATGGATGATCTCGAGATCATCCATTTCTGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032352.2-1120s1c1
Sequence:CCGGCCAAATGTAAGTGCCATGAGACTCGAGTCTCATGGCACTTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks