EMAIL THIS PAGE TO A FRIEND

BROX

BRO1 domain and CAAX motif containing

46 Gene Product Result for
Synonyms: C1orf58 RP11-452F19.1
UniProtKB ID: Q5VW32, Q96MG1
Gene ID:
Mouse(71678) BRO1 domain and CAAX motif containing
Rat(305031) BRO1 domain and CAAX motif containing
sheep(101107116) BRO1 domain and CAAX motif containing
naked mole-rat(101717856) BRO1 domain and CAAX motif containing
domestic guinea pig(100722188) BRO1 domain and CAAX motif containing
Zebrafish(492786) BRO1 domain and CAAX motif containing
cow(522319) BRO1 domain and CAAX motif containing
domestic cat(101098031) BRO1 domain and CAAX motif containing
dog(478996) BRO1 domain and CAAX motif containing
chicken(421334) BRO1 domain and CAAX motif containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144695 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144695 Rosetta Predictions human pricing
NM_001025669 Rosetta Predictions rat pricing
NM_027861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112214 predicted 1462
2 SASI_Hs01_00112215 predicted 1135
3 SASI_Hs01_00112216 predicted 881
4 SASI_Hs02_00364618 predicted 632
5 SASI_Hs01_00112217 predicted 749
6 SASI_Hs01_00112218 predicted 909
7 SASI_Hs01_00112219 predicted 939
8 SASI_Hs01_00112220 predicted 969
9 SASI_Hs01_00112221 predicted 1274
10 SASI_Hs01_00112222 predicted 632
11 SASI_Hs01_00112223 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094897 predicted 865
2 SASI_Rn01_00094898 predicted 229
3 SASI_Rn01_00094899 predicted 1181
4 SASI_Rn01_00094900 predicted 1154
5 SASI_Rn01_00094901 predicted 1217
6 SASI_Rn01_00094902 predicted 544
7 SASI_Rn01_00094903 predicted 594
8 SASI_Rn01_00094904 predicted 1035
9 SASI_Rn01_00094905 predicted 405
10 SASI_Rn01_00094906 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034954 predicted 433
2 SASI_Mm01_00034955 predicted 925
3 SASI_Mm01_00034956 predicted 668
4 SASI_Mm01_00034957 predicted 863
5 SASI_Mm02_00332815 predicted 1357
6 SASI_Mm01_00034958 predicted 985
7 SASI_Mm01_00034959 predicted 1285
8 SASI_Mm01_00034960 predicted 1387
9 SASI_Mm01_00034961 predicted 1380
10 SASI_Mm01_00034962 predicted 783
11 SASI_Mm01_00034963 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144695
VALIDATED
BROX MISSION shRNA Bacterial Glycerol Stock
BRO1 domain and CAAX motif containing
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144695.1-1186s1c1
Sequence:CCGGGTGATAAATGCGGTGAAGCAACTCGAGTTGCTTCACCGCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1170s1c1
Sequence:CCGGGAGACTTTATTGGCTAGTGATCTCGAGATCACTAGCCAATAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1251s1c1
Sequence:CCGGGCACTGTGTAAAGAATATGGACTCGAGTCCATATTCTTTACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-524s1c1
Sequence:CCGGCCTTGAACTGTTCACTGATTTCTCGAGAAATCAGTGAACAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-945s1c1
Sequence:CCGGGTTATTCAATGTCAGGCTGAACTCGAGTTCAGCCTGACATTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-632s1c1
Sequence:CCGGCCAAGAAAGCAAGTTACGATACTCGAGTATCGTAACTTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-916s21c1
Sequence:CCGGATTTAGAGTCACGACTCATAGCTCGAGCTATGAGTCGTGACTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1119s21c1
Sequence:CCGGCTTCACTTGAAGATGTGTTTCCTCGAGGAAACACATCTTCAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-743s21c1
Sequence:CCGGTAATGTAGCTTTATGGTATACCTCGAGGTATACCATAAAGCTACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1450s21c1
Sequence:CCGGAGCCTATACCTTTCGAATTTCCTCGAGGAAATTCGAAAGGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1282s21c1
Sequence:CCGGGACCTGGACCAACAGTCAAACCTCGAGGTTTGACTGTTGGTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-663s21c1
Sequence:CCGGTTCAAGTGGACTGATACATTGCTCGAGCAATGTATCAGTCCACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-818s21c1
Sequence:CCGGAGAAGTTCATCGAAGCCTAAACTCGAGTTTAGGCTTCGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-569s21c1
Sequence:CCGGGAATGCAGCAGATTCATATTTCTCGAGAAATATGAATCTGCTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144695
VALIDATED
BROX MISSION shRNA shRNA Plasmid DNA
BRO1 domain and CAAX motif containing
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144695.1-1186s1c1
Sequence:CCGGGTGATAAATGCGGTGAAGCAACTCGAGTTGCTTCACCGCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1170s1c1
Sequence:CCGGGAGACTTTATTGGCTAGTGATCTCGAGATCACTAGCCAATAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1251s1c1
Sequence:CCGGGCACTGTGTAAAGAATATGGACTCGAGTCCATATTCTTTACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-524s1c1
Sequence:CCGGCCTTGAACTGTTCACTGATTTCTCGAGAAATCAGTGAACAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-945s1c1
Sequence:CCGGGTTATTCAATGTCAGGCTGAACTCGAGTTCAGCCTGACATTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-632s1c1
Sequence:CCGGCCAAGAAAGCAAGTTACGATACTCGAGTATCGTAACTTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-916s21c1
Sequence:CCGGATTTAGAGTCACGACTCATAGCTCGAGCTATGAGTCGTGACTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1119s21c1
Sequence:CCGGCTTCACTTGAAGATGTGTTTCCTCGAGGAAACACATCTTCAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-743s21c1
Sequence:CCGGTAATGTAGCTTTATGGTATACCTCGAGGTATACCATAAAGCTACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1450s21c1
Sequence:CCGGAGCCTATACCTTTCGAATTTCCTCGAGGAAATTCGAAAGGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1282s21c1
Sequence:CCGGGACCTGGACCAACAGTCAAACCTCGAGGTTTGACTGTTGGTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-663s21c1
Sequence:CCGGTTCAAGTGGACTGATACATTGCTCGAGCAATGTATCAGTCCACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-818s21c1
Sequence:CCGGAGAAGTTCATCGAAGCCTAAACTCGAGTTTAGGCTTCGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-569s21c1
Sequence:CCGGGAATGCAGCAGATTCATATTTCTCGAGAAATATGAATCTGCTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144695
VALIDATED
BROX MISSION shRNA Lentiviral Transduction Particles
BRO1 domain and CAAX motif containing
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144695.1-1186s1c1
Sequence:CCGGGTGATAAATGCGGTGAAGCAACTCGAGTTGCTTCACCGCATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1170s1c1
Sequence:CCGGGAGACTTTATTGGCTAGTGATCTCGAGATCACTAGCCAATAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-1251s1c1
Sequence:CCGGGCACTGTGTAAAGAATATGGACTCGAGTCCATATTCTTTACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-524s1c1
Sequence:CCGGCCTTGAACTGTTCACTGATTTCTCGAGAAATCAGTGAACAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-945s1c1
Sequence:CCGGGTTATTCAATGTCAGGCTGAACTCGAGTTCAGCCTGACATTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144695.1-632s1c1
Sequence:CCGGCCAAGAAAGCAAGTTACGATACTCGAGTATCGTAACTTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-916s21c1
Sequence:CCGGATTTAGAGTCACGACTCATAGCTCGAGCTATGAGTCGTGACTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1119s21c1
Sequence:CCGGCTTCACTTGAAGATGTGTTTCCTCGAGGAAACACATCTTCAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-743s21c1
Sequence:CCGGTAATGTAGCTTTATGGTATACCTCGAGGTATACCATAAAGCTACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1450s21c1
Sequence:CCGGAGCCTATACCTTTCGAATTTCCTCGAGGAAATTCGAAAGGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-1282s21c1
Sequence:CCGGGACCTGGACCAACAGTCAAACCTCGAGGTTTGACTGTTGGTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-663s21c1
Sequence:CCGGTTCAAGTGGACTGATACATTGCTCGAGCAATGTATCAGTCCACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-818s21c1
Sequence:CCGGAGAAGTTCATCGAAGCCTAAACTCGAGTTTAGGCTTCGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144695.2-569s21c1
Sequence:CCGGGAATGCAGCAGATTCATATTTCTCGAGAAATATGAATCTGCTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027861
VALIDATED
BROX MISSION shRNA Bacterial Glycerol Stock
BRO1 domain and CAAX motif containing
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027861.1-963s1c1
Sequence:CCGGCACAGCGTATGCGTATTGCTACTCGAGTAGCAATACGCATACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-298s1c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-939s1c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-2521s1c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-1030s1c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-397s1c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027861.2-2515s21c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027861.2-2693s1c1
Sequence:CCGGCAATCAAGACAGTAGTCAATACTCGAGTATTGACTACTGTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-292s21c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-1024s21c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-933s21c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-391s21c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027861
VALIDATED
BROX MISSION shRNA shRNA Plasmid DNA
BRO1 domain and CAAX motif containing
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027861.1-963s1c1
Sequence:CCGGCACAGCGTATGCGTATTGCTACTCGAGTAGCAATACGCATACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-298s1c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-939s1c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-2521s1c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-1030s1c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-397s1c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027861.2-2515s21c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027861.2-2693s1c1
Sequence:CCGGCAATCAAGACAGTAGTCAATACTCGAGTATTGACTACTGTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-292s21c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-1024s21c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-933s21c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-391s21c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027861
VALIDATED
BROX MISSION shRNA Lentiviral Transduction Particles
BRO1 domain and CAAX motif containing
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027861.1-963s1c1
Sequence:CCGGCACAGCGTATGCGTATTGCTACTCGAGTAGCAATACGCATACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-298s1c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-939s1c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-2521s1c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-1030s1c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027861.1-397s1c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027861.2-2515s21c1
Sequence:CCGGGCTTCGCATAATAGGAATAATCTCGAGATTATTCCTATTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027861.2-2693s1c1
Sequence:CCGGCAATCAAGACAGTAGTCAATACTCGAGTATTGACTACTGTCTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-292s21c1
Sequence:CCGGCCCGCTTCAAAGATTTGCAATCTCGAGATTGCAAATCTTTGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-1024s21c1
Sequence:CCGGCGATCTCTCCAAGAAGCAGAACTCGAGTTCTGCTTCTTGGAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-933s21c1
Sequence:CCGGCCTTCACTTGAAGATGTGCTTCTCGAGAAGCACATCTTCAAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027861.2-391s21c1
Sequence:CCGGGCAGACTTGTATTTCTCTCTTCTCGAGAAGAGAGAAATACAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks