EMAIL THIS PAGE TO A FRIEND

BRPF1

bromodomain and PHD finger containing, 1

60 Gene Product Result for
Synonyms: BR140
UniProtKB ID: P55201, B4DEZ6, Q7Z6E0, Q8TCM6, Q9UHI0
Gene ID:
Human(7862) Summary: The protein encoded by this gene is expressed ubiquitously and at the highest level in testes and spermatogonia. The protein is localized within nuclei, and it is very similar in structure to two zinc finger proteins, AF10 and AF17. It is suggested that these proteins form a family of regulatory proteins. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(78783) bromodomain and PHD finger containing, 1
Rat(679713) bromodomain and PHD finger containing, 1
naked mole-rat(101726294) bromodomain and PHD finger containing, 1
domestic guinea pig(100719477) bromodomain and PHD finger containing, 1
sheep(101104433) bromodomain and PHD finger containing, 1
Zebrafish(393991) bromodomain and PHD finger containing, 1
cow(535775) bromodomain and PHD finger containing, 1
domestic cat(101083754) bromodomain and PHD finger containing, 1
Horse(100052356) bromodomain and PHD finger containing, 1
dog(484667) bromodomain and PHD finger containing, 1
chicken(427590) bromodomain and PHD finger containing, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055411 MISSION® esiRNA esiRNA targeting mouse Brpf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003694 Rosetta Predictions human pricing
NM_004634 Rosetta Predictions human pricing
XM_001054156 Rosetta Predictions rat pricing
NM_030178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129116 predicted 3353
2 SASI_Hs01_00129117 predicted 1166
3 SASI_Hs01_00129118 predicted 1504
4 SASI_Hs01_00129119 predicted 1122
5 SASI_Hs01_00129121 predicted 4073
6 SASI_Hs01_00129122 predicted 3905
7 SASI_Hs01_00129123 predicted 3283
8 SASI_Hs01_00129124 predicted 4060
9 SASI_Hs01_00129125 predicted 2640
10 SASI_Hs02_00304324 predicted 3307
11 SASI_Hs01_00129120 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189588 predicted 3333
2 SASI_Hs01_00189589 predicted 1164
3 SASI_Hs01_00189590 predicted 1507
4 SASI_Hs01_00189591 predicted 1123
5 SASI_Hs01_00189593 predicted 4056
6 SASI_Hs01_00189594 predicted 3887
7 SASI_Hs01_00189595 predicted 3270
8 SASI_Hs01_00189596 predicted 4047
9 SASI_Hs01_00189597 predicted 2616
10 SASI_Hs02_00338036 predicted 3295
11 SASI_Hs01_00189592 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274924 predicted 749
2 SASI_Rn02_00274925 predicted 1415
3 SASI_Rn02_00274926 predicted 844
4 SASI_Rn02_00274927 predicted 1072
5 SASI_Rn02_00274928 predicted 1026
6 SASI_Rn02_00274929 predicted 1768
7 SASI_Rn02_00274930 predicted 4044
8 SASI_Rn02_00274931 predicted 630
9 SASI_Rn02_00274932 predicted 3816
10 SASI_Rn02_00274933 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336585 predicted 2199
2 SASI_Mm01_00178595 predicted 869
3 SASI_Mm01_00178596 predicted 581
4 SASI_Mm01_00178597 predicted 3801
5 SASI_Mm01_00178598 predicted 914
6 SASI_Mm01_00178600 predicted 1249
7 SASI_Mm01_00178601 predicted 490
8 SASI_Mm01_00178602 predicted 470
9 SASI_Mm01_00178603 predicted 3739
10 SASI_Mm02_00336586 predicted 2370
11 SASI_Mm01_00178599 predicted 2006
12 SASI_Mm01_00178604 predicted 3844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004634
VALIDATED
BRPF1 MISSION shRNA Bacterial Glycerol Stock
bromodomain and PHD finger containing, 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3349s21c1
Sequence:CCGGAGTTTCTTGGTATACCGTAATCTCGAGATTACGGTATACCAAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2134s21c1
Sequence:CCGGGATAAGAACTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-1166s21c1
Sequence:CCGGCGTACTTTGAGAGTCATAATACTCGAGTATTATGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3676s21c1
Sequence:CCGGTGCCGAGGCTATCCATCATACCTCGAGGTATGATGGATAGCCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4522s21c1
Sequence:CCGGCTCATTTGTAACTGCGTTTCCCTCGAGGGAAACGCAGTTACAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2448s21c1
Sequence:CCGGGGCTTACCGCTACCTGAATTTCTCGAGAAATTCAGGTAGCGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4373s21c1
Sequence:CCGGATGCCAGGAGAATCCATAACTCTCGAGAGTTATGGATTCTCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-2924s1c1
Sequence:CCGGCCAATGGACTTACCAGCCAATCTCGAGATTGGCTGGTAAGTCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-1577s1c1
Sequence:CCGGCCACCACACAGGCTTAGTAAACTCGAGTTTACTAAGCCTGTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004634.1-352s1c1
Sequence:CCGGCCGCATCAGCATCTTTGACAACTCGAGTTGTCAAAGATGCTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-112s1c1
Sequence:CCGGCCGAAAGGTCTACAAGAGTTACTCGAGTAACTCTTGTAGACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004634
VALIDATED
BRPF1 MISSION shRNA shRNA Plasmid DNA
bromodomain and PHD finger containing, 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3349s21c1
Sequence:CCGGAGTTTCTTGGTATACCGTAATCTCGAGATTACGGTATACCAAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2134s21c1
Sequence:CCGGGATAAGAACTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-1166s21c1
Sequence:CCGGCGTACTTTGAGAGTCATAATACTCGAGTATTATGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3676s21c1
Sequence:CCGGTGCCGAGGCTATCCATCATACCTCGAGGTATGATGGATAGCCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4522s21c1
Sequence:CCGGCTCATTTGTAACTGCGTTTCCCTCGAGGGAAACGCAGTTACAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2448s21c1
Sequence:CCGGGGCTTACCGCTACCTGAATTTCTCGAGAAATTCAGGTAGCGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4373s21c1
Sequence:CCGGATGCCAGGAGAATCCATAACTCTCGAGAGTTATGGATTCTCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-2924s1c1
Sequence:CCGGCCAATGGACTTACCAGCCAATCTCGAGATTGGCTGGTAAGTCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-1577s1c1
Sequence:CCGGCCACCACACAGGCTTAGTAAACTCGAGTTTACTAAGCCTGTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004634.1-352s1c1
Sequence:CCGGCCGCATCAGCATCTTTGACAACTCGAGTTGTCAAAGATGCTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-112s1c1
Sequence:CCGGCCGAAAGGTCTACAAGAGTTACTCGAGTAACTCTTGTAGACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004634
VALIDATED
BRPF1 MISSION shRNA Lentiviral Transduction Particles
bromodomain and PHD finger containing, 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3349s21c1
Sequence:CCGGAGTTTCTTGGTATACCGTAATCTCGAGATTACGGTATACCAAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2134s21c1
Sequence:CCGGGATAAGAACTGGGCCCTTAAACTCGAGTTTAAGGGCCCAGTTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-1166s21c1
Sequence:CCGGCGTACTTTGAGAGTCATAATACTCGAGTATTATGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-3676s21c1
Sequence:CCGGTGCCGAGGCTATCCATCATACCTCGAGGTATGATGGATAGCCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4522s21c1
Sequence:CCGGCTCATTTGTAACTGCGTTTCCCTCGAGGGAAACGCAGTTACAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004634.2-2448s21c1
Sequence:CCGGGGCTTACCGCTACCTGAATTTCTCGAGAAATTCAGGTAGCGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004634.2-4373s21c1
Sequence:CCGGATGCCAGGAGAATCCATAACTCTCGAGAGTTATGGATTCTCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-2924s1c1
Sequence:CCGGCCAATGGACTTACCAGCCAATCTCGAGATTGGCTGGTAAGTCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-1577s1c1
Sequence:CCGGCCACCACACAGGCTTAGTAAACTCGAGTTTACTAAGCCTGTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004634.1-352s1c1
Sequence:CCGGCCGCATCAGCATCTTTGACAACTCGAGTTGTCAAAGATGCTGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004634.1-112s1c1
Sequence:CCGGCCGAAAGGTCTACAAGAGTTACTCGAGTAACTCTTGTAGACCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030178
VALIDATED
BRPF1 MISSION shRNA Bacterial Glycerol Stock
bromodomain and PHD finger containing, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1606s21c1
Sequence:CCGGCAAGGCCAAGTCTCGGATTAACTCGAGTTAATCCGAGACTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-741s21c1
Sequence:CCGGACTACCGGTACATCGAGAAATCTCGAGATTTCTCGATGTACCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1813s21c1
Sequence:CCGGACTACTCAGGCGCCTACAAACCTCGAGGTTTGTAGGCGCCTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-797s21c1
Sequence:CCGGATGGATGAAGAGGACTATATCCTCGAGGATATAGTCCTCTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030178.1-3958s21c1
Sequence:CCGGCCGCCCTCTGCACTGATTAATCTCGAGATTAATCAGTGCAGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030178.1-4157s1c1
Sequence:CCGGCCACAGTAAGAATACTGTAAACTCGAGTTTACAGTATTCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030178.1-193s1c1
Sequence:CCGGGCGGGCAACTAAGCCACCATACTCGAGTATGGTGGCTTAGTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-915s1c1
Sequence:CCGGCGTACTTTGAGAGTCACAATACTCGAGTATTGTGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-2204s1c1
Sequence:CCGGCGCTACTTGAACTTTGATGATCTCGAGATCATCAAAGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030178
VALIDATED
BRPF1 MISSION shRNA shRNA Plasmid DNA
bromodomain and PHD finger containing, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1606s21c1
Sequence:CCGGCAAGGCCAAGTCTCGGATTAACTCGAGTTAATCCGAGACTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-741s21c1
Sequence:CCGGACTACCGGTACATCGAGAAATCTCGAGATTTCTCGATGTACCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1813s21c1
Sequence:CCGGACTACTCAGGCGCCTACAAACCTCGAGGTTTGTAGGCGCCTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-797s21c1
Sequence:CCGGATGGATGAAGAGGACTATATCCTCGAGGATATAGTCCTCTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030178.1-3958s21c1
Sequence:CCGGCCGCCCTCTGCACTGATTAATCTCGAGATTAATCAGTGCAGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030178.1-4157s1c1
Sequence:CCGGCCACAGTAAGAATACTGTAAACTCGAGTTTACAGTATTCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030178.1-193s1c1
Sequence:CCGGGCGGGCAACTAAGCCACCATACTCGAGTATGGTGGCTTAGTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-915s1c1
Sequence:CCGGCGTACTTTGAGAGTCACAATACTCGAGTATTGTGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-2204s1c1
Sequence:CCGGCGCTACTTGAACTTTGATGATCTCGAGATCATCAAAGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030178
VALIDATED
BRPF1 MISSION shRNA Lentiviral Transduction Particles
bromodomain and PHD finger containing, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1606s21c1
Sequence:CCGGCAAGGCCAAGTCTCGGATTAACTCGAGTTAATCCGAGACTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-741s21c1
Sequence:CCGGACTACCGGTACATCGAGAAATCTCGAGATTTCTCGATGTACCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-1813s21c1
Sequence:CCGGACTACTCAGGCGCCTACAAACCTCGAGGTTTGTAGGCGCCTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030178.1-797s21c1
Sequence:CCGGATGGATGAAGAGGACTATATCCTCGAGGATATAGTCCTCTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030178.1-3958s21c1
Sequence:CCGGCCGCCCTCTGCACTGATTAATCTCGAGATTAATCAGTGCAGAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030178.1-4157s1c1
Sequence:CCGGCCACAGTAAGAATACTGTAAACTCGAGTTTACAGTATTCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030178.1-193s1c1
Sequence:CCGGGCGGGCAACTAAGCCACCATACTCGAGTATGGTGGCTTAGTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-915s1c1
Sequence:CCGGCGTACTTTGAGAGTCACAATACTCGAGTATTGTGACTCTCAAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030178.1-2204s1c1
Sequence:CCGGCGCTACTTGAACTTTGATGATCTCGAGATCATCAAAGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks