EMAIL THIS PAGE TO A FRIEND

BRPF3

bromodomain and PHD finger containing, 3

UniProtKB ID: Q9ULD4, A6NJE2, Q5R3K8
Gene ID:
Mouse(268936) bromodomain and PHD finger containing, 3
Rat(309647) bromodomain and PHD finger containing, 3
Zebrafish(100003354) bromodomain and PHD finger containing, 3
chicken(421182) bromodomain and PHD finger containing, 3
cow(507996) bromodomain and PHD finger containing, 3
Horse(100063594) bromodomain and PHD finger containing, 3
domestic cat(101080286) bromodomain and PHD finger containing, 3
dog(481762) bromodomain and PHD finger containing, 3
Zebrafish(100149254) bromodomain and PHD finger containing, 3
sheep(101120116) bromodomain and PHD finger containing, 3
Domestic Rabbit(100344918) bromodomain and PHD finger containing, 3
domestic guinea pig(100723008) bromodomain and PHD finger containing, 3
naked mole-rat(101714150) bromodomain and PHD finger containing, 3
232 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015695 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015695 Rosetta Predictions human pricing
NM_001107615 Rosetta Predictions rat pricing
NM_001081315 Rosetta Predictions mouse pricing
XM_196171 Rosetta Predictions mouse pricing
XM_892549 Rosetta Predictions mouse pricing
XM_900138 Rosetta Predictions mouse pricing
XM_900145 Rosetta Predictions mouse pricing
XM_900149 Rosetta Predictions mouse pricing
XM_900153 Rosetta Predictions mouse pricing
XM_992849 Rosetta Predictions mouse pricing
XM_992907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198008 predicted 734
2 SASI_Hs01_00198009 predicted 335
3 SASI_Hs01_00198010 predicted 2205
4 SASI_Hs01_00198011 predicted 410
5 SASI_Hs01_00198012 predicted 2416
6 SASI_Hs01_00198013 predicted 1930
7 SASI_Hs02_00348357 predicted 2309
8 SASI_Hs01_00198014 predicted 2598
9 SASI_Hs01_00198015 predicted 3253
10 SASI_Hs02_00348358 predicted 2089
11 SASI_Hs01_00198007 predicted 3618
12 SASI_Hs01_00198016 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230575 predicted 2017
2 SASI_Rn02_00230576 predicted 2017
3 SASI_Rn02_00230577 predicted 2006
4 SASI_Rn02_00230578 predicted 2104
5 SASI_Rn02_00230579 predicted 1904
6 SASI_Rn02_00230580 predicted 2652
7 SASI_Rn02_00230581 predicted 3041
8 SASI_Rn02_00230582 predicted 430
9 SASI_Rn02_00230583 predicted 2699
10 SASI_Rn02_00230584 predicted 3153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297211 predicted 3802
2 SASI_Mm02_00297212 predicted 2033
3 SASI_Mm02_00297213 predicted 371
4 SASI_Mm02_00297214 predicted 2386
5 SASI_Mm02_00297215 predicted 3050
6 SASI_Mm02_00297216 predicted 3294
7 SASI_Mm02_00297217 predicted 3951
8 SASI_Mm02_00297218 predicted 2853
9 SASI_Mm02_00297219 predicted 665
10 SASI_Mm02_00297220 predicted 2575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_196171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275923 predicted 274
2 SASI_Mm01_00275924 predicted 1842
3 SASI_Mm01_00275925 predicted 2203
4 SASI_Mm01_00275926 predicted 2874
5 SASI_Mm01_00275927 predicted 3101
6 SASI_Mm01_00275928 predicted 3595
7 SASI_Mm01_00275929 predicted 471
8 SASI_Mm01_00275930 predicted 2388
9 SASI_Mm01_00275931 predicted 1084
10 SASI_Mm01_00275932 predicted 3215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246827 predicted 3803
2 SASI_Mm01_00246828 predicted 473
3 SASI_Mm01_00246829 predicted 2031
4 SASI_Mm01_00246830 predicted 382
5 SASI_Mm01_00246831 predicted 2391
6 SASI_Mm01_00246832 predicted 3058
7 SASI_Mm01_00246833 predicted 3292
8 SASI_Mm01_00246834 predicted 3955
9 SASI_Mm01_00246835 predicted 664
10 SASI_Mm01_00246836 predicted 2578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218360 predicted 451
2 SASI_Mm01_00218361 predicted 289
3 SASI_Mm01_00218362 predicted 796
4 SASI_Mm01_00218363 predicted 600
5 SASI_Mm01_00218364 predicted 866
6 SASI_Mm01_00218365 predicted 341
7 SASI_Mm01_00218366 predicted 874
8 SASI_Mm01_00218367 predicted 663
9 SASI_Mm01_00218368 predicted 905
10 SASI_Mm01_00218369 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234659 predicted 282
2 SASI_Mm01_00234660 predicted 273
3 SASI_Mm01_00234661 predicted 745
4 SASI_Mm01_00234662 predicted 978
5 SASI_Mm01_00234663 predicted 1047
6 SASI_Mm01_00234664 predicted 966
7 SASI_Mm01_00234665 predicted 1078
8 SASI_Mm01_00234666 predicted 473
9 SASI_Mm01_00234667 predicted 732
10 SASI_Mm01_00234668 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239292 predicted 677
2 SASI_Mm01_00239293 predicted 518
3 SASI_Mm01_00239294 predicted 408
4 SASI_Mm01_00239295 predicted 831
5 SASI_Mm01_00239296 predicted 1089
6 SASI_Mm01_00239297 predicted 571
7 SASI_Mm01_00239298 predicted 402
8 SASI_Mm01_00239299 predicted 1092
9 SASI_Mm01_00239300 predicted 889
10 SASI_Mm01_00239301 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229531 predicted 1076
2 SASI_Mm01_00229532 predicted 925
3 SASI_Mm01_00229533 predicted 1433
4 SASI_Mm01_00229534 predicted 789
5 SASI_Mm01_00229535 predicted 1227
6 SASI_Mm01_00229536 predicted 1489
7 SASI_Mm01_00229537 predicted 971
8 SASI_Mm01_00229538 predicted 1502
9 SASI_Mm01_00229539 predicted 1293
10 SASI_Mm01_00229540 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216727 predicted 275
2 SASI_Mm01_00216728 predicted 1722
3 SASI_Mm01_00216729 predicted 2078
4 SASI_Mm01_00216730 predicted 2742
5 SASI_Mm01_00216731 predicted 2976
6 SASI_Mm01_00216732 predicted 3464
7 SASI_Mm01_00216733 predicted 480
8 SASI_Mm01_00216734 predicted 2258
9 SASI_Mm01_00216735 predicted 1075
10 SASI_Mm01_00216736 predicted 3084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250966 predicted 600
2 SASI_Mm01_00250967 predicted 446
3 SASI_Mm01_00250968 predicted 338
4 SASI_Mm01_00250969 predicted 751
5 SASI_Mm01_00250970 predicted 1013
6 SASI_Mm01_00250971 predicted 329
7 SASI_Mm01_00250972 predicted 203
8 SASI_Mm01_00250973 predicted 1023
9 SASI_Mm01_00250974 predicted 825
10 SASI_Mm01_00250975 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166450
VALIDATED
BRPF3 MISSION shRNA Bacterial Glycerol Stock
bromodomain and PHD finger containing, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2190s1c1
Sequence:CCGGGAGGACTTTAACCTTATAGTTCTCGAGAACTATAAGGTTAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1183s1c1
Sequence:CCGGGCTGGAAACTAACCTGCTATACTCGAGTATAGCAGGTTAGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1112s1c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-339s1c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2595s1c1
Sequence:CCGGCCATCACTCAACAAGACAGTACTCGAGTACTGTCTTGTTGAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166450
VALIDATED
BRPF3 MISSION shRNA shRNA Plasmid DNA
bromodomain and PHD finger containing, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2190s1c1
Sequence:CCGGGAGGACTTTAACCTTATAGTTCTCGAGAACTATAAGGTTAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1183s1c1
Sequence:CCGGGCTGGAAACTAACCTGCTATACTCGAGTATAGCAGGTTAGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1112s1c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-339s1c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2595s1c1
Sequence:CCGGCCATCACTCAACAAGACAGTACTCGAGTACTGTCTTGTTGAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166450
VALIDATED
BRPF3 MISSION shRNA Lentiviral Transduction Particles
bromodomain and PHD finger containing, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2190s1c1
Sequence:CCGGGAGGACTTTAACCTTATAGTTCTCGAGAACTATAAGGTTAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1183s1c1
Sequence:CCGGGCTGGAAACTAACCTGCTATACTCGAGTATAGCAGGTTAGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-1112s1c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_166450.2-339s1c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166450.2-2595s1c1
Sequence:CCGGCCATCACTCAACAAGACAGTACTCGAGTACTGTCTTGTTGAGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015695
VALIDATED
BRPF3 MISSION shRNA Bacterial Glycerol Stock
bromodomain and PHD finger containing, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-2188s21c1
Sequence:GTACCGGAGGAGGACTTTAACCTTATAGCTCGAGCTATAAGGTTAAAGTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-339s21c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015695.2-4336s21c1
Sequence:GTACCGGTCCCATCTTCTGCACCCATTGCTCGAGCAATGGGTGCAGAAGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1112s21c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4291s21c1
Sequence:CCGGTCACACTCTCTCCCGCTTATCCTCGAGGATAAGCGGGAGAGAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015695.2-1763s21c1
Sequence:CCGGACGGAATGGTGTCCCTCTTATCTCGAGATAAGAGGGACACCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1135s21c1
Sequence:CCGGCCGTGTTCTTGGAACCTATTGCTCGAGCAATAGGTTCCAAGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4082s21c1
Sequence:GTACCGGGAACCAGTTAGAAGTAGAAACCTCGAGGTTTCTACTTCTAACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015695
VALIDATED
BRPF3 MISSION shRNA shRNA Plasmid DNA
bromodomain and PHD finger containing, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-2188s21c1
Sequence:GTACCGGAGGAGGACTTTAACCTTATAGCTCGAGCTATAAGGTTAAAGTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-339s21c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015695.2-4336s21c1
Sequence:GTACCGGTCCCATCTTCTGCACCCATTGCTCGAGCAATGGGTGCAGAAGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1112s21c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4291s21c1
Sequence:CCGGTCACACTCTCTCCCGCTTATCCTCGAGGATAAGCGGGAGAGAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015695.2-1763s21c1
Sequence:CCGGACGGAATGGTGTCCCTCTTATCTCGAGATAAGAGGGACACCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1135s21c1
Sequence:CCGGCCGTGTTCTTGGAACCTATTGCTCGAGCAATAGGTTCCAAGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4082s21c1
Sequence:GTACCGGGAACCAGTTAGAAGTAGAAACCTCGAGGTTTCTACTTCTAACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015695
VALIDATED
BRPF3 MISSION shRNA Lentiviral Transduction Particles
bromodomain and PHD finger containing, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-2188s21c1
Sequence:GTACCGGAGGAGGACTTTAACCTTATAGCTCGAGCTATAAGGTTAAAGTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-339s21c1
Sequence:CCGGCGGATTGTCGAGGTAGACATTCTCGAGAATGTCTACCTCGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015695.2-4336s21c1
Sequence:GTACCGGTCCCATCTTCTGCACCCATTGCTCGAGCAATGGGTGCAGAAGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1112s21c1
Sequence:CCGGCCCTGAAGTCTGCTTTGCTAACTCGAGTTAGCAAAGCAGACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4291s21c1
Sequence:CCGGTCACACTCTCTCCCGCTTATCCTCGAGGATAAGCGGGAGAGAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015695.2-1763s21c1
Sequence:CCGGACGGAATGGTGTCCCTCTTATCTCGAGATAAGAGGGACACCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-1135s21c1
Sequence:CCGGCCGTGTTCTTGGAACCTATTGCTCGAGCAATAGGTTCCAAGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015695.2-4082s21c1
Sequence:GTACCGGGAACCAGTTAGAAGTAGAAACCTCGAGGTTTCTACTTCTAACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081315
BRPF3 MISSION shRNA Bacterial Glycerol Stock
bromodomain and PHD finger containing, 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081315.1-4009s21c1
Sequence:CCGGCCGAGGGCAAGACCCAATATTCTCGAGAATATTGGGTCTTGCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1390s21c1
Sequence:CCGGTGTTCGCAAGACTGCGTATTGCTCGAGCAATACGCAGTCTTGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1153s21c1
Sequence:CCGGTGAGGTCTGCTTCGCTAATACCTCGAGGTATTAGCGAAGCAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-954s21c1
Sequence:CCGGTCTGCGACATCTGCAACTTAGCTCGAGCTAAGTTGCAGATGTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081315
BRPF3 MISSION shRNA shRNA Plasmid DNA
bromodomain and PHD finger containing, 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081315.1-4009s21c1
Sequence:CCGGCCGAGGGCAAGACCCAATATTCTCGAGAATATTGGGTCTTGCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1390s21c1
Sequence:CCGGTGTTCGCAAGACTGCGTATTGCTCGAGCAATACGCAGTCTTGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1153s21c1
Sequence:CCGGTGAGGTCTGCTTCGCTAATACCTCGAGGTATTAGCGAAGCAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-954s21c1
Sequence:CCGGTCTGCGACATCTGCAACTTAGCTCGAGCTAAGTTGCAGATGTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081315
BRPF3 MISSION shRNA Lentiviral Transduction Particles
bromodomain and PHD finger containing, 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081315.1-4009s21c1
Sequence:CCGGCCGAGGGCAAGACCCAATATTCTCGAGAATATTGGGTCTTGCCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1390s21c1
Sequence:CCGGTGTTCGCAAGACTGCGTATTGCTCGAGCAATACGCAGTCTTGCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-1153s21c1
Sequence:CCGGTGAGGTCTGCTTCGCTAATACCTCGAGGTATTAGCGAAGCAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081315.1-954s21c1
Sequence:CCGGTCTGCGACATCTGCAACTTAGCTCGAGCTAAGTTGCAGATGTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks