EMAIL THIS PAGE TO A FRIEND

BRS3

bombesin-like receptor 3

52 Gene Product Result for
UniProtKB ID: P32247
Gene ID:
Human(680) Summary: The protein encoded by this gene is a G protein-coupled membrane receptor that binds bombesin-like peptides. This binding results in activation of a phosphatidylinositol-calcium second messenger system, with physiological effects including regulation of metabolic rate, glucose metabolism, and hypertension. [provided by RefSeq, Sep 2011]
Mouse(12209) bombesin-like receptor 3
Rat(260319) bombesin-like receptor 3
chicken(378927) bombesin-like receptor 3
cow(539011) bombesin-like receptor 3
domestic cat(101098778) bombesin-like receptor 3
dog(613002) bombesin-like receptor 3
naked mole-rat(101714813) bombesin-like receptor 3
domestic guinea pig(100135488) bombesin-like receptor 3
sheep(443044) bombesin-like receptor 3
Domestic Rabbit(100357683) bombesin-like receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001727 Rosetta Predictions human pricing
NM_152845 Rosetta Predictions rat pricing
NM_009766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332429 predicted 375
2 SASI_Hs02_00332430 predicted 1134
3 SASI_Hs01_00025468 predicted 532
4 SASI_Hs01_00025469 predicted 281
5 SASI_Hs01_00025470 predicted 337
6 SASI_Hs01_00025471 predicted 497
7 SASI_Hs01_00025472 predicted 329
8 SASI_Hs01_00025474 predicted 258
9 SASI_Hs01_00025475 predicted 1168
10 SASI_Hs02_00332431 predicted 509
11 SASI_Hs01_00025467 predicted 479
12 SASI_Hs01_00025473 predicted 549
13 SASI_Hs01_00025476 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038499 predicted 266
2 SASI_Rn01_00038500 predicted 970
3 SASI_Rn01_00038501 predicted 223
4 SASI_Rn01_00038502 predicted 699
5 SASI_Rn01_00038503 predicted 980
6 SASI_Rn01_00038504 predicted 991
7 SASI_Rn01_00038505 predicted 806
8 SASI_Rn01_00038506 predicted 399
9 SASI_Rn01_00038507 predicted 515
10 SASI_Rn02_00268909 predicted 1026
11 SASI_Rn01_00038508 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164925 predicted 321
2 SASI_Mm02_00316963 predicted 563
3 SASI_Mm01_00164926 predicted 276
4 SASI_Mm01_00164927 predicted 1407
5 SASI_Mm01_00164928 predicted 199
6 SASI_Mm01_00164929 predicted 775
7 SASI_Mm01_00164930 predicted 1057
8 SASI_Mm01_00164931 predicted 1429
9 SASI_Mm01_00164932 predicted 747
10 SASI_Mm01_00164933 predicted 441
11 SASI_Mm01_00164934 predicted 1464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001727
BRS3 MISSION shRNA Bacterial Glycerol Stock
bombesin-like receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-657s21c1
Sequence:CCGGTGCGTCTGGATCGTGTCTATGCTCGAGCATAGACACGATCCAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-683s21c1
Sequence:CCGGTGCTCTACCTGAGGCTATATTCTCGAGAATATAGCCTCAGGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-291s21c1
Sequence:CCGGTGTGCCATCTATATTACTTATCTCGAGATAAGTAATATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-862s1c1
Sequence:CCGGCCTTGATTGCTAGGACCCTTTCTCGAGAAAGGGTCCTAGCAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-684s1c1
Sequence:CCGGGCTCTACCTGAGGCTATATTTCTCGAGAAATATAGCCTCAGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-1105s1c1
Sequence:CCGGCTTTCAGCAATTCTTGCGTAACTCGAGTTACGCAAGAATTGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-627s1c1
Sequence:CCGGGCCATCCTGAAGACTTGTGTACTCGAGTACACAAGTCTTCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-220s1c1
Sequence:CCGGGCTCTGTGGTTTCTAACGATACTCGAGTATCGTTAGAAACCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001727
BRS3 MISSION shRNA shRNA Plasmid DNA
bombesin-like receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-657s21c1
Sequence:CCGGTGCGTCTGGATCGTGTCTATGCTCGAGCATAGACACGATCCAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-683s21c1
Sequence:CCGGTGCTCTACCTGAGGCTATATTCTCGAGAATATAGCCTCAGGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-291s21c1
Sequence:CCGGTGTGCCATCTATATTACTTATCTCGAGATAAGTAATATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-862s1c1
Sequence:CCGGCCTTGATTGCTAGGACCCTTTCTCGAGAAAGGGTCCTAGCAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-684s1c1
Sequence:CCGGGCTCTACCTGAGGCTATATTTCTCGAGAAATATAGCCTCAGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-1105s1c1
Sequence:CCGGCTTTCAGCAATTCTTGCGTAACTCGAGTTACGCAAGAATTGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-627s1c1
Sequence:CCGGGCCATCCTGAAGACTTGTGTACTCGAGTACACAAGTCTTCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-220s1c1
Sequence:CCGGGCTCTGTGGTTTCTAACGATACTCGAGTATCGTTAGAAACCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001727
BRS3 MISSION shRNA Lentiviral Transduction Particles
bombesin-like receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-657s21c1
Sequence:CCGGTGCGTCTGGATCGTGTCTATGCTCGAGCATAGACACGATCCAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-683s21c1
Sequence:CCGGTGCTCTACCTGAGGCTATATTCTCGAGAATATAGCCTCAGGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001727.1-291s21c1
Sequence:CCGGTGTGCCATCTATATTACTTATCTCGAGATAAGTAATATAGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-862s1c1
Sequence:CCGGCCTTGATTGCTAGGACCCTTTCTCGAGAAAGGGTCCTAGCAATCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-684s1c1
Sequence:CCGGGCTCTACCTGAGGCTATATTTCTCGAGAAATATAGCCTCAGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-1105s1c1
Sequence:CCGGCTTTCAGCAATTCTTGCGTAACTCGAGTTACGCAAGAATTGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-627s1c1
Sequence:CCGGGCCATCCTGAAGACTTGTGTACTCGAGTACACAAGTCTTCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001727.1-220s1c1
Sequence:CCGGGCTCTGTGGTTTCTAACGATACTCGAGTATCGTTAGAAACCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009766
VALIDATED
BRS3 MISSION shRNA Bacterial Glycerol Stock
bombesin-like receptor 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-306s21c1
Sequence:CCGGAGCACTGTGTGCCATCTATATCTCGAGATATAGATGGCACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1503s21c1
Sequence:CCGGGTAATAGACAAACCATCATTTCTCGAGAAATGATGGTTTGTCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-849s21c1
Sequence:CCGGCATTATCCCGCTCTCGATTATCTCGAGATAATCGAGAGCGGGATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-705s21c1
Sequence:CCGGTGCTCTGCCAGAGGCTATATTCTCGAGAATATAGCCTCTGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-253s21c1
Sequence:CCGGTCCAACGATACTACACATAAACTCGAGTTTATGTGTAGTATCGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1045s21c1
Sequence:CCGGCTCTACCACTCCTTCACTTATCTCGAGATAAGTGAAGGAGTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-514s21c1
Sequence:CCGGTTTGGAAAGGTCGGTTGTAAACTCGAGTTTACAACCGACCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-571s21c1
Sequence:CCGGTCAGTGTTCACGCTAACAATTCTCGAGAATTGTTAGCGTGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009766.2-752s1c1
Sequence:CCGGCCTAACAGAAATGTGACATTTCTCGAGAAATGTCACATTTCTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-358s1c1
Sequence:CCGGCCTCGGAAATGCTATCCTCATCTCGAGATGAGGATAGCATTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-860s1c1
Sequence:CCGGCTCTCGATTATCTCTGTCTATCTCGAGATAGACAGAGATAATCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-216s1c1
Sequence:CCGGCCATTACAAATGACACAGAAACTCGAGTTTCTGTGTCATTTGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009766.2-1628s1c1
Sequence:CCGGGCTGTATAGAAGGGATGGTAACTCGAGTTACCATCCCTTCTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009766
VALIDATED
BRS3 MISSION shRNA shRNA Plasmid DNA
bombesin-like receptor 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-306s21c1
Sequence:CCGGAGCACTGTGTGCCATCTATATCTCGAGATATAGATGGCACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1503s21c1
Sequence:CCGGGTAATAGACAAACCATCATTTCTCGAGAAATGATGGTTTGTCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-849s21c1
Sequence:CCGGCATTATCCCGCTCTCGATTATCTCGAGATAATCGAGAGCGGGATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-705s21c1
Sequence:CCGGTGCTCTGCCAGAGGCTATATTCTCGAGAATATAGCCTCTGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-253s21c1
Sequence:CCGGTCCAACGATACTACACATAAACTCGAGTTTATGTGTAGTATCGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1045s21c1
Sequence:CCGGCTCTACCACTCCTTCACTTATCTCGAGATAAGTGAAGGAGTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-514s21c1
Sequence:CCGGTTTGGAAAGGTCGGTTGTAAACTCGAGTTTACAACCGACCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-571s21c1
Sequence:CCGGTCAGTGTTCACGCTAACAATTCTCGAGAATTGTTAGCGTGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009766.2-752s1c1
Sequence:CCGGCCTAACAGAAATGTGACATTTCTCGAGAAATGTCACATTTCTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-358s1c1
Sequence:CCGGCCTCGGAAATGCTATCCTCATCTCGAGATGAGGATAGCATTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-860s1c1
Sequence:CCGGCTCTCGATTATCTCTGTCTATCTCGAGATAGACAGAGATAATCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-216s1c1
Sequence:CCGGCCATTACAAATGACACAGAAACTCGAGTTTCTGTGTCATTTGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009766.2-1628s1c1
Sequence:CCGGGCTGTATAGAAGGGATGGTAACTCGAGTTACCATCCCTTCTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009766
VALIDATED
BRS3 MISSION shRNA Lentiviral Transduction Particles
bombesin-like receptor 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-306s21c1
Sequence:CCGGAGCACTGTGTGCCATCTATATCTCGAGATATAGATGGCACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1503s21c1
Sequence:CCGGGTAATAGACAAACCATCATTTCTCGAGAAATGATGGTTTGTCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-849s21c1
Sequence:CCGGCATTATCCCGCTCTCGATTATCTCGAGATAATCGAGAGCGGGATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-705s21c1
Sequence:CCGGTGCTCTGCCAGAGGCTATATTCTCGAGAATATAGCCTCTGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-253s21c1
Sequence:CCGGTCCAACGATACTACACATAAACTCGAGTTTATGTGTAGTATCGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-1045s21c1
Sequence:CCGGCTCTACCACTCCTTCACTTATCTCGAGATAAGTGAAGGAGTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009766.3-514s21c1
Sequence:CCGGTTTGGAAAGGTCGGTTGTAAACTCGAGTTTACAACCGACCTTTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009766.3-571s21c1
Sequence:CCGGTCAGTGTTCACGCTAACAATTCTCGAGAATTGTTAGCGTGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009766.2-752s1c1
Sequence:CCGGCCTAACAGAAATGTGACATTTCTCGAGAAATGTCACATTTCTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-358s1c1
Sequence:CCGGCCTCGGAAATGCTATCCTCATCTCGAGATGAGGATAGCATTTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-860s1c1
Sequence:CCGGCTCTCGATTATCTCTGTCTATCTCGAGATAGACAGAGATAATCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009766.2-216s1c1
Sequence:CCGGCCATTACAAATGACACAGAAACTCGAGTTTCTGTGTCATTTGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009766.2-1628s1c1
Sequence:CCGGGCTGTATAGAAGGGATGGTAACTCGAGTTACCATCCCTTCTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks