EMAIL THIS PAGE TO A FRIEND

BRSK1

BR serine/threonine kinase 1

87 Gene Product Result for
Synonyms: hSAD1
Gene ID:
Mouse(381979) BR serine/threonine kinase 1
Rat(499073) BR serine/threonine kinase 1
sheep(101121543) BR serine/threonine kinase 1
domestic guinea pig(100713263) BR serine/threonine kinase 1
naked mole-rat(101708179) BR serine/threonine kinase 1
cow(538009) BR serine/threonine kinase 1
Horse(100055612) BR serine/threonine kinase 1
domestic cat(101091827) BR serine/threonine kinase 1
dog(484297) BR serine/threonine kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132741 MISSION® esiRNA esiRNA human BRSK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032430 Rosetta Predictions human pricing
NM_001127337 Rosetta Predictions rat pricing
NM_001003920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213403 predicted 1988
2 SASI_Hs01_00213404 predicted 662
3 SASI_Hs01_00213405 predicted 568
4 SASI_Hs01_00213406 predicted 1094
5 SASI_Hs01_00213407 predicted 564
6 SASI_Hs01_00213408 predicted 1995
7 SASI_Hs01_00213409 predicted 784
8 SASI_Hs01_00213410 predicted 1098
9 SASI_Hs01_00213411 predicted 541
10 SASI_Hs01_00213412 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253623 predicted 2061
2 SASI_Rn02_00253624 predicted 1860
3 SASI_Rn02_00253625 predicted 385
4 SASI_Rn02_00253626 predicted 844
5 SASI_Rn02_00253627 predicted 1651
6 SASI_Rn02_00253628 predicted 697
7 SASI_Rn02_00253629 predicted 1371
8 SASI_Rn02_00253630 predicted 1280
9 SASI_Rn02_00253631 predicted 341
10 SASI_Rn02_00253632 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144509 predicted 998
2 SASI_Mm01_00144510 predicted 1226
3 SASI_Mm02_00286374 predicted 895
4 SASI_Mm02_00286375 predicted 968
5 SASI_Mm01_00144511 predicted 444
6 SASI_Mm01_00144512 predicted 486
7 SASI_Mm01_00144514 predicted 528
8 SASI_Mm01_00144515 predicted 1429
9 SASI_Mm01_00144516 predicted 1185
10 SASI_Mm01_00144518 predicted 559
11 SASI_Mm01_00144513 predicted 550
12 SASI_Mm01_00144517 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032430
VALIDATED
BRSK1 MISSION shRNA Bacterial Glycerol Stock
BR serine/threonine kinase 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-627s1c1
Sequence:CCGGAGCTATTCGACTACCTGGTAACTCGAGTTACCAGGTAGTCGAATAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-2131s1c1
Sequence:CCGGCAGCATCAAAGCAGACATCGTCTCGAGACGATGTCTGCTTTGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-1029s1c1
Sequence:CCGGCCCACTTCATTCCTCCAGATTCTCGAGAATCTGGAGGAATGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.x-2667s1c1
Sequence:CCGGCCCAACTGTGAATCTGTAAATCTCGAGATTTACAGATTCACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032430.x-1115s1c1
Sequence:CCGGCAGAAACATCCTTGGTACCTACTCGAGTAGGTACCAAGGATGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2906s1c1
Sequence:CCGGGCTTAGCAGATCCGGACAGGGCTCGAGCCCTGTCCGGATCTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2922s1c1
Sequence:CCGGCAGGGCCCTCTGTCCCTGTGTCTCGAGACACAGGGACAGAGGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-2096s1c1
Sequence:CCGGCAAATATTCCTCGTGCTAAAGCTCGAGCTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-568s1c1
Sequence:CCGGCGACGTCTACGAGAACAAGAACTCGAGTTCTTGTTCTCGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-1226s1c1
Sequence:CCGGCCCGACGTCCTAGAGAGCATGCTCGAGCATGCTCTCTAGGACGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-570s21c1
Sequence:GTACCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2686s21c1
Sequence:CCGGATAAGGCCCAAGGAACATGTCCTCGAGGACATGTTCCTTGGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-2095s21c1
Sequence:CCGGACAAATATTCCTCGTGCTAAACTCGAGTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-866s21c1
Sequence:CCGGGCGTGTCCAGAGGTGATTAAGCTCGAGCTTAATCACCTCTGGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-731s21c1
Sequence:CCGGATCTGCCACAGAGACCTAAAGCTCGAGCTTTAGGTCTCTGTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-1094s21c1
Sequence:CCGGAGGCTCAGTCTGGAGCAAATTCTCGAGAATTTGCTCCAGACTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2668s21c1
Sequence:CCGGCCAACTGTGAATCTGTAAATACTCGAGTATTTACAGATTCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-404s21c1
Sequence:CCGGGGACAGACAGGGCTGGTTAAACTCGAGTTTAACCAGCCCTGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032430
VALIDATED
BRSK1 MISSION shRNA shRNA Plasmid DNA
BR serine/threonine kinase 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-627s1c1
Sequence:CCGGAGCTATTCGACTACCTGGTAACTCGAGTTACCAGGTAGTCGAATAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-2131s1c1
Sequence:CCGGCAGCATCAAAGCAGACATCGTCTCGAGACGATGTCTGCTTTGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-1029s1c1
Sequence:CCGGCCCACTTCATTCCTCCAGATTCTCGAGAATCTGGAGGAATGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.x-2667s1c1
Sequence:CCGGCCCAACTGTGAATCTGTAAATCTCGAGATTTACAGATTCACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032430.x-1115s1c1
Sequence:CCGGCAGAAACATCCTTGGTACCTACTCGAGTAGGTACCAAGGATGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2906s1c1
Sequence:CCGGGCTTAGCAGATCCGGACAGGGCTCGAGCCCTGTCCGGATCTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2922s1c1
Sequence:CCGGCAGGGCCCTCTGTCCCTGTGTCTCGAGACACAGGGACAGAGGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-2096s1c1
Sequence:CCGGCAAATATTCCTCGTGCTAAAGCTCGAGCTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-568s1c1
Sequence:CCGGCGACGTCTACGAGAACAAGAACTCGAGTTCTTGTTCTCGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-1226s1c1
Sequence:CCGGCCCGACGTCCTAGAGAGCATGCTCGAGCATGCTCTCTAGGACGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-570s21c1
Sequence:GTACCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2686s21c1
Sequence:CCGGATAAGGCCCAAGGAACATGTCCTCGAGGACATGTTCCTTGGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-2095s21c1
Sequence:CCGGACAAATATTCCTCGTGCTAAACTCGAGTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-866s21c1
Sequence:CCGGGCGTGTCCAGAGGTGATTAAGCTCGAGCTTAATCACCTCTGGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-731s21c1
Sequence:CCGGATCTGCCACAGAGACCTAAAGCTCGAGCTTTAGGTCTCTGTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-1094s21c1
Sequence:CCGGAGGCTCAGTCTGGAGCAAATTCTCGAGAATTTGCTCCAGACTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2668s21c1
Sequence:CCGGCCAACTGTGAATCTGTAAATACTCGAGTATTTACAGATTCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-404s21c1
Sequence:CCGGGGACAGACAGGGCTGGTTAAACTCGAGTTTAACCAGCCCTGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032430
VALIDATED
BRSK1 MISSION shRNA Lentiviral Transduction Particles
BR serine/threonine kinase 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-627s1c1
Sequence:CCGGAGCTATTCGACTACCTGGTAACTCGAGTTACCAGGTAGTCGAATAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-2131s1c1
Sequence:CCGGCAGCATCAAAGCAGACATCGTCTCGAGACGATGTCTGCTTTGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.x-1029s1c1
Sequence:CCGGCCCACTTCATTCCTCCAGATTCTCGAGAATCTGGAGGAATGAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.x-2667s1c1
Sequence:CCGGCCCAACTGTGAATCTGTAAATCTCGAGATTTACAGATTCACAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032430.x-1115s1c1
Sequence:CCGGCAGAAACATCCTTGGTACCTACTCGAGTAGGTACCAAGGATGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2906s1c1
Sequence:CCGGGCTTAGCAGATCCGGACAGGGCTCGAGCCCTGTCCGGATCTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032430.1-2922s1c1
Sequence:CCGGCAGGGCCCTCTGTCCCTGTGTCTCGAGACACAGGGACAGAGGGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-2096s1c1
Sequence:CCGGCAAATATTCCTCGTGCTAAAGCTCGAGCTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-568s1c1
Sequence:CCGGCGACGTCTACGAGAACAAGAACTCGAGTTCTTGTTCTCGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032430.1-1226s1c1
Sequence:CCGGCCCGACGTCCTAGAGAGCATGCTCGAGCATGCTCTCTAGGACGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-570s21c1
Sequence:GTACCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2686s21c1
Sequence:CCGGATAAGGCCCAAGGAACATGTCCTCGAGGACATGTTCCTTGGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-2095s21c1
Sequence:CCGGACAAATATTCCTCGTGCTAAACTCGAGTTTAGCACGAGGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-866s21c1
Sequence:CCGGGCGTGTCCAGAGGTGATTAAGCTCGAGCTTAATCACCTCTGGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-731s21c1
Sequence:CCGGATCTGCCACAGAGACCTAAAGCTCGAGCTTTAGGTCTCTGTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-1094s21c1
Sequence:CCGGAGGCTCAGTCTGGAGCAAATTCTCGAGAATTTGCTCCAGACTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032430.1-2668s21c1
Sequence:CCGGCCAACTGTGAATCTGTAAATACTCGAGTATTTACAGATTCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032430.1-404s21c1
Sequence:CCGGGGACAGACAGGGCTGGTTAAACTCGAGTTTAACCAGCCCTGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356021
BRSK1 MISSION shRNA Bacterial Glycerol Stock
BR serine/threonine kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-72s1c1
Sequence:CCGGCTTCCACATGCCTCACTTCATCTCGAGATGAAGTGAGGCATGTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-484s1c1
Sequence:CCGGCCACCTCGTAAGCGTGTGGATCTCGAGATCCACACGCTTACGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-257s1c1
Sequence:CCGGGCCGCAGAGTAGCCATGCGTACTCGAGTACGCATGGCTACTCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1453s1c1
Sequence:CCGGCGTCGGTTCAAACGTGTGGTACTCGAGTACCACACGTTTGAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1157s1c1
Sequence:CCGGCCTTGGACAAAGAAGAACAAACTCGAGTTTGTTCTTCTTTGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356021
BRSK1 MISSION shRNA shRNA Plasmid DNA
BR serine/threonine kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-72s1c1
Sequence:CCGGCTTCCACATGCCTCACTTCATCTCGAGATGAAGTGAGGCATGTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-484s1c1
Sequence:CCGGCCACCTCGTAAGCGTGTGGATCTCGAGATCCACACGCTTACGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-257s1c1
Sequence:CCGGGCCGCAGAGTAGCCATGCGTACTCGAGTACGCATGGCTACTCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1453s1c1
Sequence:CCGGCGTCGGTTCAAACGTGTGGTACTCGAGTACCACACGTTTGAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1157s1c1
Sequence:CCGGCCTTGGACAAAGAAGAACAAACTCGAGTTTGTTCTTCTTTGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356021
BRSK1 MISSION shRNA Lentiviral Transduction Particles
BR serine/threonine kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-72s1c1
Sequence:CCGGCTTCCACATGCCTCACTTCATCTCGAGATGAAGTGAGGCATGTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-484s1c1
Sequence:CCGGCCACCTCGTAAGCGTGTGGATCTCGAGATCCACACGCTTACGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-257s1c1
Sequence:CCGGGCCGCAGAGTAGCCATGCGTACTCGAGTACGCATGGCTACTCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1453s1c1
Sequence:CCGGCGTCGGTTCAAACGTGTGGTACTCGAGTACCACACGTTTGAACCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356021.1-1157s1c1
Sequence:CCGGCCTTGGACAAAGAAGAACAAACTCGAGTTTGTTCTTCTTTGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003920
BRSK1 MISSION shRNA Bacterial Glycerol Stock
BR serine/threonine kinase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000368711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-798s21c1
Sequence:CCGGGCTGTGGAGTCATCCTATTTGCTCGAGCAAATAGGATGACTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003920.2-2542s21c1
Sequence:CCGGCCTACTGTGAATCTGTATATACTCGAGTATATACAGATTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-444s21c1
Sequence:CCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-396s21c1
Sequence:CCGGTCGCCATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003920
BRSK1 MISSION shRNA shRNA Plasmid DNA
BR serine/threonine kinase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000368711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-798s21c1
Sequence:CCGGGCTGTGGAGTCATCCTATTTGCTCGAGCAAATAGGATGACTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003920.2-2542s21c1
Sequence:CCGGCCTACTGTGAATCTGTATATACTCGAGTATATACAGATTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-444s21c1
Sequence:CCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-396s21c1
Sequence:CCGGTCGCCATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003920
BRSK1 MISSION shRNA Lentiviral Transduction Particles
BR serine/threonine kinase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000368711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-798s21c1
Sequence:CCGGGCTGTGGAGTCATCCTATTTGCTCGAGCAAATAGGATGACTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003920.2-2542s21c1
Sequence:CCGGCCTACTGTGAATCTGTATATACTCGAGTATATACAGATTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-444s21c1
Sequence:CCGGACGTCTACGAGAACAAGAAATCTCGAGATTTCTTGTTCTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003920.2-396s21c1
Sequence:CCGGTCGCCATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks