EMAIL THIS PAGE TO A FRIEND

BRSK2

BR serine/threonine kinase 2

Synonyms: C11orf7 PEN11B SAD1 SADA STK29
UniProtKB ID: Q8IWQ3, O60843, O95099, Q5J5B4, Q6ZMQ4, Q8TB60
Gene ID:
Mouse(75770) BR serine/threonine kinase 2
Rat(293631) BR serine/threonine kinase 2
chicken(423098) BR serine/threonine kinase 2
dog(483658) BR serine/threonine kinase 2
cow(535868) BR serine/threonine kinase 2
domestic cat(101096106) BR serine/threonine kinase 2
naked mole-rat(101717881) BR serine/threonine kinase 2
domestic guinea pig(100724913) BR serine/threonine kinase 2
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003957 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038791 MISSION® esiRNA esiRNA targeting mouse Brsk2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003957 Rosetta Predictions human pricing
XM_001063734 Rosetta Predictions rat pricing
XM_219498 Rosetta Predictions rat pricing
NM_001009929 Rosetta Predictions mouse pricing
NM_001009930 Rosetta Predictions mouse pricing
NM_029426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065624 predicted 1155
2 SASI_Hs01_00065625 predicted 1084
3 SASI_Hs01_00065626 predicted 2179
4 SASI_Hs01_00065627 predicted 2142
5 SASI_Hs01_00065628 predicted 1092
6 SASI_Hs01_00065629 predicted 1213
7 SASI_Hs01_00065630 predicted 2023
8 SASI_Hs01_00065631 predicted 2083
9 SASI_Hs01_00065632 predicted 1977
10 SASI_Hs01_00065633 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308145 predicted 780
2 SASI_Rn02_00308146 predicted 584
3 SASI_Rn02_00308147 predicted 509
4 SASI_Rn02_00308148 predicted 1060
5 SASI_Rn02_00308149 predicted 1287
6 SASI_Rn02_00308150 predicted 2012
7 SASI_Rn02_00308151 predicted 773
8 SASI_Rn02_00308152 predicted 440
9 SASI_Rn02_00308153 predicted 1677
10 SASI_Rn02_00308154 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378495 predicted 1577
2 SASI_Rn02_00378496 predicted 1250
3 SASI_Rn02_00378497 predicted 1291
4 SASI_Rn02_00378498 predicted 1464
5 SASI_Rn02_00378499 predicted 1167
6 SASI_Rn02_00378500 predicted 1543
7 SASI_Rn02_00378501 predicted 1250
8 SASI_Rn02_00378502 predicted 1502
9 SASI_Rn02_00378503 predicted 1573
10 SASI_Rn02_00378504 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169068 predicted 1031
2 SASI_Mm01_00169070 predicted 1599
3 SASI_Mm01_00169071 predicted 706
4 SASI_Mm01_00169072 predicted 604
5 SASI_Mm01_00169073 predicted 531
6 SASI_Mm01_00169074 predicted 868
7 SASI_Mm01_00169075 predicted 1218
8 SASI_Mm01_00169076 predicted 790
9 SASI_Mm01_00169077 predicted 464
10 SASI_Mm02_00286873 predicted 1702
11 SASI_Mm01_00169069 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088363 predicted 1027
2 SASI_Mm01_00088365 predicted 1597
3 SASI_Mm01_00088366 predicted 709
4 SASI_Mm01_00088367 predicted 602
5 SASI_Mm01_00088368 predicted 537
6 SASI_Mm01_00088369 predicted 864
7 SASI_Mm01_00088370 predicted 1218
8 SASI_Mm01_00088371 predicted 790
9 SASI_Mm01_00088372 predicted 463
10 SASI_Mm02_00286874 predicted 1705
11 SASI_Mm01_00088364 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335326 predicted 527
2 SASI_Mm02_00335327 predicted 1360
3 SASI_Mm02_00335328 predicted 1932
4 SASI_Mm02_00335329 predicted 1046
5 SASI_Mm02_00335330 predicted 944
6 SASI_Mm02_00335331 predicted 870
7 SASI_Mm02_00335332 predicted 1201
8 SASI_Mm02_00335333 predicted 794
9 SASI_Mm02_00335334 predicted 2038
10 SASI_Mm02_00335335 predicted 1963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029426
BRSK2 MISSION shRNA Bacterial Glycerol Stock
BR serine/threonine kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029426.2-2789s21c1
Sequence:CCGGGCTGGGCTGAGACCAGTATTACTCGAGTAATACTGGTCTCAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-2014s21c1
Sequence:CCGGGCCTCAGCCACAGCGTTATTTCTCGAGAAATAACGCTGTGGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-520s21c1
Sequence:CCGGTGAAGGTGGAGCGAGAGATTGCTCGAGCAATCTCTCGCTCCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029426.1-3126s1c1
Sequence:CCGGGCAGAGCTAGAGTTTGTGTTTCTCGAGAAACACAAACTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-530s1c1
Sequence:CCGGGCGAGAGATTGCCATCTTGAACTCGAGTTCAAGATGGCAATCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2159s1c1
Sequence:CCGGCTACTCAGTCACATTCACTTTCTCGAGAAAGTGAATGTGACTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2023s1c1
Sequence:CCGGACAGCGTTATTTCCCAGACAACTCGAGTTGTCTGGGAAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-789s1c1
Sequence:CCGGGAGAGGAACAACATCCGTATTCTCGAGAATACGGATGTTGTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029426
BRSK2 MISSION shRNA shRNA Plasmid DNA
BR serine/threonine kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029426.2-2789s21c1
Sequence:CCGGGCTGGGCTGAGACCAGTATTACTCGAGTAATACTGGTCTCAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-2014s21c1
Sequence:CCGGGCCTCAGCCACAGCGTTATTTCTCGAGAAATAACGCTGTGGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-520s21c1
Sequence:CCGGTGAAGGTGGAGCGAGAGATTGCTCGAGCAATCTCTCGCTCCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029426.1-3126s1c1
Sequence:CCGGGCAGAGCTAGAGTTTGTGTTTCTCGAGAAACACAAACTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-530s1c1
Sequence:CCGGGCGAGAGATTGCCATCTTGAACTCGAGTTCAAGATGGCAATCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2159s1c1
Sequence:CCGGCTACTCAGTCACATTCACTTTCTCGAGAAAGTGAATGTGACTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2023s1c1
Sequence:CCGGACAGCGTTATTTCCCAGACAACTCGAGTTGTCTGGGAAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-789s1c1
Sequence:CCGGGAGAGGAACAACATCCGTATTCTCGAGAATACGGATGTTGTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029426
BRSK2 MISSION shRNA Lentiviral Transduction Particles
BR serine/threonine kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029426.2-2789s21c1
Sequence:CCGGGCTGGGCTGAGACCAGTATTACTCGAGTAATACTGGTCTCAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-2014s21c1
Sequence:CCGGGCCTCAGCCACAGCGTTATTTCTCGAGAAATAACGCTGTGGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029426.2-520s21c1
Sequence:CCGGTGAAGGTGGAGCGAGAGATTGCTCGAGCAATCTCTCGCTCCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029426.1-3126s1c1
Sequence:CCGGGCAGAGCTAGAGTTTGTGTTTCTCGAGAAACACAAACTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-530s1c1
Sequence:CCGGGCGAGAGATTGCCATCTTGAACTCGAGTTCAAGATGGCAATCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2159s1c1
Sequence:CCGGCTACTCAGTCACATTCACTTTCTCGAGAAAGTGAATGTGACTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-2023s1c1
Sequence:CCGGACAGCGTTATTTCCCAGACAACTCGAGTTGTCTGGGAAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029426.1-789s1c1
Sequence:CCGGGAGAGGAACAACATCCGTATTCTCGAGAATACGGATGTTGTTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003957
BRSK2 MISSION shRNA Bacterial Glycerol Stock
BR serine/threonine kinase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-621s1c1
Sequence:CCGGCTAAAGCTGCACGACGTTTATCTCGAGATAAACGTCGTGCAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-586s1c1
Sequence:CCGGTCGCGATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-1037s1c1
Sequence:CCGGCGATGACAACTTGCGACAGCTCTCGAGAGCTGTCGCAAGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003957.1-3098s1c1
Sequence:CCGGCGAGCTACTGTAAACTTTAAACTCGAGTTTAAAGTTTACAGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-743s1c1
Sequence:CCGGGAAGTTCTTCCGGCAGATCATCTCGAGATGATCTGCCGGAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003957.x-2938s1c1
Sequence:CCGGCAGTGTTATTTATTTGCCGTTCTCGAGAACGGCAAATAAATAACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-2330s1c1
Sequence:CCGGCACTAACTGTATGGAAATGATCTCGAGATCATTTCCATACAGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1367s1c1
Sequence:CCGGGAACCAGGAGAAGATGATTTACTCGAGTAAATCATCTTCTCCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1820s1c1
Sequence:CCGGGCTCAACTCCATCAAGAACAGCTCGAGCTGTTCTTGATGGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-831s1c1
Sequence:CCGGCTGGACGAGAAGAACAACATCCTCGAGGATGTTGTTCTTCTCGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003957
BRSK2 MISSION shRNA shRNA Plasmid DNA
BR serine/threonine kinase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-621s1c1
Sequence:CCGGCTAAAGCTGCACGACGTTTATCTCGAGATAAACGTCGTGCAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-586s1c1
Sequence:CCGGTCGCGATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-1037s1c1
Sequence:CCGGCGATGACAACTTGCGACAGCTCTCGAGAGCTGTCGCAAGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003957.1-3098s1c1
Sequence:CCGGCGAGCTACTGTAAACTTTAAACTCGAGTTTAAAGTTTACAGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-743s1c1
Sequence:CCGGGAAGTTCTTCCGGCAGATCATCTCGAGATGATCTGCCGGAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003957.x-2938s1c1
Sequence:CCGGCAGTGTTATTTATTTGCCGTTCTCGAGAACGGCAAATAAATAACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-2330s1c1
Sequence:CCGGCACTAACTGTATGGAAATGATCTCGAGATCATTTCCATACAGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1367s1c1
Sequence:CCGGGAACCAGGAGAAGATGATTTACTCGAGTAAATCATCTTCTCCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1820s1c1
Sequence:CCGGGCTCAACTCCATCAAGAACAGCTCGAGCTGTTCTTGATGGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-831s1c1
Sequence:CCGGCTGGACGAGAAGAACAACATCCTCGAGGATGTTGTTCTTCTCGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003957
BRSK2 MISSION shRNA Lentiviral Transduction Particles
BR serine/threonine kinase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-621s1c1
Sequence:CCGGCTAAAGCTGCACGACGTTTATCTCGAGATAAACGTCGTGCAGCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.2-586s1c1
Sequence:CCGGTCGCGATCCTGAAGCTCATTGCTCGAGCAATGAGCTTCAGGATCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-1037s1c1
Sequence:CCGGCGATGACAACTTGCGACAGCTCTCGAGAGCTGTCGCAAGTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003957.1-3098s1c1
Sequence:CCGGCGAGCTACTGTAAACTTTAAACTCGAGTTTAAAGTTTACAGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003957.1-743s1c1
Sequence:CCGGGAAGTTCTTCCGGCAGATCATCTCGAGATGATCTGCCGGAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003957.x-2938s1c1
Sequence:CCGGCAGTGTTATTTATTTGCCGTTCTCGAGAACGGCAAATAAATAACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-2330s1c1
Sequence:CCGGCACTAACTGTATGGAAATGATCTCGAGATCATTTCCATACAGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1367s1c1
Sequence:CCGGGAACCAGGAGAAGATGATTTACTCGAGTAAATCATCTTCTCCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-1820s1c1
Sequence:CCGGGCTCAACTCCATCAAGAACAGCTCGAGCTGTTCTTGATGGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003957.x-831s1c1
Sequence:CCGGCTGGACGAGAAGAACAACATCCTCGAGGATGTTGTTCTTCTCGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks