EMAIL THIS PAGE TO A FRIEND

BRWD1

bromodomain and WD repeat domain containing 1

379 Gene Product Result for
Synonyms: C21orf107 N143 WDR9
Gene ID:
Human(54014) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
Mouse(93871) bromodomain and WD repeat domain containing 1
Rat(304061) bromodomain and WD repeat domain containing 1
Zebrafish(798858) bromodomain and WD repeat domain containing 1
chicken(418521) bromodomain and WD repeat domain containing 1
dog(487764) bromodomain and WD repeat domain containing 1
cow(540661) bromodomain and WD repeat domain containing 1
domestic guinea pig(100713169) bromodomain and WD repeat domain containing 1
naked mole-rat(101714700) bromodomain and WD repeat domain containing 1
sheep(101117901) bromodomain and WD repeat domain containing 1
Domestic Rabbit(100328651) bromodomain and WD repeat domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007246 Rosetta Predictions human pricing
NM_018963 Rosetta Predictions human pricing
NM_033656 Rosetta Predictions human pricing
NM_001107106 Rosetta Predictions rat pricing
NM_001103179 Rosetta Predictions mouse pricing
NM_145125 Rosetta Predictions mouse pricing
NM_176928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175076 predicted 725
2 SASI_Hs01_00175077 predicted 508
3 SASI_Hs01_00175078 predicted 691
4 SASI_Hs01_00175079 predicted 348
5 SASI_Hs01_00175080 predicted 412
6 SASI_Hs01_00175081 predicted 480
7 SASI_Hs01_00175082 predicted 324
8 SASI_Hs01_00175083 predicted 272
9 SASI_Hs01_00175084 predicted 544
10 SASI_Hs01_00175085 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135510 predicted 5225
2 SASI_Hs01_00135511 predicted 777
3 SASI_Hs01_00135513 predicted 5863
4 SASI_Hs01_00135514 predicted 5125
5 SASI_Hs01_00135515 predicted 1602
6 SASI_Hs01_00135516 predicted 3527
7 SASI_Hs01_00135517 predicted 3763
8 SASI_Hs01_00135518 predicted 3720
9 SASI_Hs02_00352441 predicted 6158
10 SASI_Hs02_00352442 predicted 1505
11 SASI_Hs01_00135509 predicted 408
12 SASI_Hs01_00135512 predicted 4620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028783 predicted 5232
2 SASI_Hs01_00028784 predicted 774
3 SASI_Hs01_00028786 predicted 5855
4 SASI_Hs01_00028787 predicted 5127
5 SASI_Hs01_00028788 predicted 1609
6 SASI_Hs01_00028789 predicted 3527
7 SASI_Hs01_00028790 predicted 3756
8 SASI_Hs01_00028791 predicted 3723
9 SASI_Hs02_00361465 predicted 6160
10 SASI_Hs02_00361466 predicted 1506
11 SASI_Hs01_00028782 predicted 411
12 SASI_Hs01_00028785 predicted 4626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225556 predicted 3420
2 SASI_Rn02_00225557 predicted 5752
3 SASI_Rn02_00225558 predicted 5573
4 SASI_Rn02_00225559 predicted 5356
5 SASI_Rn02_00225560 predicted 5977
6 SASI_Rn02_00225561 predicted 5284
7 SASI_Rn02_00225562 predicted 5905
8 SASI_Rn02_00225563 predicted 6497
9 SASI_Rn02_00225564 predicted 5522
10 SASI_Rn02_00225565 predicted 6413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303194 predicted 3932
2 SASI_Mm02_00303195 predicted 5210
3 SASI_Mm02_00303196 predicted 739
4 SASI_Mm02_00303197 predicted 1939
5 SASI_Mm02_00303198 predicted 3824
6 SASI_Mm02_00303199 predicted 1989
7 SASI_Mm02_00303200 predicted 6310
8 SASI_Mm02_00303201 predicted 3753
9 SASI_Mm02_00303202 predicted 2204
10 SASI_Mm02_00303203 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065048 predicted 3929
2 SASI_Mm01_00065049 predicted 5211
3 SASI_Mm01_00065050 predicted 737
4 SASI_Mm01_00065051 predicted 1940
5 SASI_Mm01_00065053 predicted 3822
6 SASI_Mm01_00065054 predicted 1995
7 SASI_Mm01_00065055 predicted 6306
8 SASI_Mm01_00065056 predicted 3750
9 SASI_Mm02_00340511 predicted 2204
10 SASI_Mm01_00065057 predicted 1252
11 SASI_Mm01_00065052 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346812 predicted 312
2 SASI_Mm02_00346813 predicted 573
3 SASI_Mm02_00346814 predicted 557
4 SASI_Mm02_00346815 predicted 629
5 SASI_Mm02_00346816 predicted 623
6 SASI_Mm02_00346817 predicted 490
7 SASI_Mm02_00346818 predicted 378
8 SASI_Mm02_00346819 predicted 425
9 SASI_Mm02_00346820 predicted 664
10 SASI_Mm02_00346821 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018963
BRWD1 MISSION shRNA Bacterial Glycerol Stock
bromodomain and WD repeat domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018963.3-7345s1c1
Sequence:CCGGGCCTGCTATAAGACTACTATTCTCGAGAATAGTAGTCTTATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-4288s1c1
Sequence:CCGGGCTGATATTTAGCAATGCAAACTCGAGTTTGCATTGCTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-688s1c1
Sequence:CCGGCGGACATCTATCTGCTGTTTACTCGAGTAAACAGCAGATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-2575s1c1
Sequence:CCGGGCGTGAGTTATCTTCTGGAAACTCGAGTTTCCAGAAGATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-792s1c1
Sequence:CCGGGCCGCTTGTTATCTACATTAACTCGAGTTAATGTAGATAACAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1824s21c1
Sequence:CCGGCTGACTATCGACCACTTATTACTCGAGTAATAAGTGGTCGATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-4931s21c1
Sequence:CCGGACTCGAAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1601s21c1
Sequence:CCGGGGACATGATGGCAGCATATTTCTCGAGAAATATGCTGCCATCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018963
BRWD1 MISSION shRNA shRNA Plasmid DNA
bromodomain and WD repeat domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018963.3-7345s1c1
Sequence:CCGGGCCTGCTATAAGACTACTATTCTCGAGAATAGTAGTCTTATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-4288s1c1
Sequence:CCGGGCTGATATTTAGCAATGCAAACTCGAGTTTGCATTGCTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-688s1c1
Sequence:CCGGCGGACATCTATCTGCTGTTTACTCGAGTAAACAGCAGATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-2575s1c1
Sequence:CCGGGCGTGAGTTATCTTCTGGAAACTCGAGTTTCCAGAAGATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-792s1c1
Sequence:CCGGGCCGCTTGTTATCTACATTAACTCGAGTTAATGTAGATAACAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1824s21c1
Sequence:CCGGCTGACTATCGACCACTTATTACTCGAGTAATAAGTGGTCGATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-4931s21c1
Sequence:CCGGACTCGAAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1601s21c1
Sequence:CCGGGGACATGATGGCAGCATATTTCTCGAGAAATATGCTGCCATCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018963
BRWD1 MISSION shRNA Lentiviral Transduction Particles
bromodomain and WD repeat domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018963.3-7345s1c1
Sequence:CCGGGCCTGCTATAAGACTACTATTCTCGAGAATAGTAGTCTTATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-4288s1c1
Sequence:CCGGGCTGATATTTAGCAATGCAAACTCGAGTTTGCATTGCTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-688s1c1
Sequence:CCGGCGGACATCTATCTGCTGTTTACTCGAGTAAACAGCAGATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-2575s1c1
Sequence:CCGGGCGTGAGTTATCTTCTGGAAACTCGAGTTTCCAGAAGATAACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018963.3-792s1c1
Sequence:CCGGGCCGCTTGTTATCTACATTAACTCGAGTTAATGTAGATAACAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1824s21c1
Sequence:CCGGCTGACTATCGACCACTTATTACTCGAGTAATAAGTGGTCGATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-4931s21c1
Sequence:CCGGACTCGAAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018963.3-1601s21c1
Sequence:CCGGGGACATGATGGCAGCATATTTCTCGAGAAATATGCTGCCATCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145125
VALIDATED
BRWD1 MISSION shRNA Bacterial Glycerol Stock
bromodomain and WD repeat domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145125.1-7670s1c1
Sequence:CCGGGCCAGACTTGTGGTCAGAAATCTCGAGATTTCTGACCACAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-1603s1c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-2435s1c1
Sequence:CCGGCCTGTATGTAATAGGGAGAAACTCGAGTTTCTCCCTATTACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-4273s1c1
Sequence:CCGGGCAAAGACATTCGATTGATATCTCGAGATATCAATCGAATGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-5744s1c1
Sequence:CCGGCGGATCTGTATCACTAGAGAACTCGAGTTCTCTAGTGATACAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145125.3-7514s21c1
Sequence:CCGGAGACTGTCATTAATGTCTTATCTCGAGATAAGACATTAATGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-4930s21c1
Sequence:CCGGACTCGGAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-1598s21c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-2514s21c1
Sequence:CCGGACGGACGTGTAGGCGTAAATACTCGAGTATTTACGCCTACACGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-3829s21c1
Sequence:CCGGCATAATGCAAGAACGTTTAATCTCGAGATTAAACGTTCTTGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145125
VALIDATED
BRWD1 MISSION shRNA shRNA Plasmid DNA
bromodomain and WD repeat domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145125.1-7670s1c1
Sequence:CCGGGCCAGACTTGTGGTCAGAAATCTCGAGATTTCTGACCACAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-1603s1c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-2435s1c1
Sequence:CCGGCCTGTATGTAATAGGGAGAAACTCGAGTTTCTCCCTATTACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-4273s1c1
Sequence:CCGGGCAAAGACATTCGATTGATATCTCGAGATATCAATCGAATGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-5744s1c1
Sequence:CCGGCGGATCTGTATCACTAGAGAACTCGAGTTCTCTAGTGATACAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145125.3-7514s21c1
Sequence:CCGGAGACTGTCATTAATGTCTTATCTCGAGATAAGACATTAATGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-4930s21c1
Sequence:CCGGACTCGGAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-1598s21c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-2514s21c1
Sequence:CCGGACGGACGTGTAGGCGTAAATACTCGAGTATTTACGCCTACACGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-3829s21c1
Sequence:CCGGCATAATGCAAGAACGTTTAATCTCGAGATTAAACGTTCTTGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145125
VALIDATED
BRWD1 MISSION shRNA Lentiviral Transduction Particles
bromodomain and WD repeat domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145125.1-7670s1c1
Sequence:CCGGGCCAGACTTGTGGTCAGAAATCTCGAGATTTCTGACCACAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-1603s1c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145125.1-2435s1c1
Sequence:CCGGCCTGTATGTAATAGGGAGAAACTCGAGTTTCTCCCTATTACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-4273s1c1
Sequence:CCGGGCAAAGACATTCGATTGATATCTCGAGATATCAATCGAATGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145125.1-5744s1c1
Sequence:CCGGCGGATCTGTATCACTAGAGAACTCGAGTTCTCTAGTGATACAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145125.3-7514s21c1
Sequence:CCGGAGACTGTCATTAATGTCTTATCTCGAGATAAGACATTAATGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-4930s21c1
Sequence:CCGGACTCGGAAGAGAGTCTATTTACTCGAGTAAATAGACTCTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-1598s21c1
Sequence:CCGGGCAGCATATTTATATGGGATACTCGAGTATCCCATATAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-2514s21c1
Sequence:CCGGACGGACGTGTAGGCGTAAATACTCGAGTATTTACGCCTACACGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145125.3-3829s21c1
Sequence:CCGGCATAATGCAAGAACGTTTAATCTCGAGATTAAACGTTCTTGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks