EMAIL THIS PAGE TO A FRIEND

BRWD3

bromodomain and WD repeat domain containing 3

93 Gene Product Result for
Synonyms: BRODL MRX93
Gene ID:
Human(254065) Summary: The protein encoded by this gene contains a bromodomain and several WD repeats. It is thought to have a chromatin-modifying function, and may thus play a role in transcription. Mutations in this gene cause mental retardation X-linked type 93, which is also referred to as mental retardation X-linked with macrocephaly. This gene is also associated with translocations in patients with B-cell chronic lymphocytic leukemia. [provided by RefSeq, May 2010]
Mouse(382236) bromodomain and WD repeat domain containing 3
Rat(317213) bromodomain and WD repeat domain containing 3
Zebrafish(553209) bromodomain and WD repeat domain containing 3
cow(534539) bromodomain and WD repeat domain containing 3
Horse(100071730) bromodomain and WD repeat domain containing 3
domestic cat(101091925) bromodomain and WD repeat domain containing 3
dog(491984) bromodomain and WD repeat domain containing 3
chicken(422281) bromodomain and WD repeat domain containing 3
fruit fly(42898) CG31132 gene product from transcript CG31132-RA
sheep(101120385) bromodomain and WD repeat domain containing 3
naked mole-rat(101707459) bromodomain and WD repeat domain containing 3
domestic guinea pig(100733885) bromodomain and WD repeat domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012802 Anti-BRWD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501055 Anti-BRWD3, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153252 Rosetta Predictions human pricing
XM_001054667 Rosetta Predictions rat pricing
XM_228518 Rosetta Predictions rat pricing
NM_001081477 Rosetta Predictions mouse pricing
XM_897902 Rosetta Predictions mouse pricing
XM_897923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067975 predicted 3409
2 SASI_Hs02_00367112 predicted 1963
3 SASI_Hs01_00067978 predicted 486
4 SASI_Hs01_00067979 predicted 1930
5 SASI_Hs01_00067980 predicted 4184
6 SASI_Hs01_00067981 predicted 1211
7 SASI_Hs01_00067982 predicted 2063
8 SASI_Hs02_00367113 predicted 1517
9 SASI_Hs01_00067983 predicted 2747
10 SASI_Hs02_00367114 predicted 4518
11 SASI_Hs01_00067974 predicted 766
12 SASI_Hs01_00067976 predicted 2234
13 SASI_Hs01_00067977 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276737 predicted 2450
2 SASI_Rn02_00276738 predicted 2197
3 SASI_Rn02_00276739 predicted 3770
4 SASI_Rn02_00276740 predicted 710
5 SASI_Rn02_00276741 predicted 3873
6 SASI_Rn02_00276742 predicted 2731
7 SASI_Rn02_00276743 predicted 1004
8 SASI_Rn02_00276744 predicted 3593
9 SASI_Rn02_00276745 predicted 2712
10 SASI_Rn02_00276746 predicted 3003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385182 predicted 1771
2 SASI_Rn02_00385183 predicted 1207
3 SASI_Rn02_00385184 predicted 3251
4 SASI_Rn02_00385185 predicted 851
5 SASI_Rn02_00385186 predicted 3352
6 SASI_Rn02_00385187 predicted 2202
7 SASI_Rn02_00385188 predicted 903
8 SASI_Rn02_00385189 predicted 2187
9 SASI_Rn02_00385190 predicted 2088
10 SASI_Rn02_00385191 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298600 predicted 5661
2 SASI_Mm02_00298601 predicted 3882
3 SASI_Mm02_00298602 predicted 3768
4 SASI_Mm02_00298603 predicted 2447
5 SASI_Mm02_00298604 predicted 1519
6 SASI_Mm02_00298605 predicted 3906
7 SASI_Mm02_00298606 predicted 1005
8 SASI_Mm02_00298607 predicted 963
9 SASI_Mm02_00298608 predicted 4447
10 SASI_Mm02_00298609 predicted 2759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252429 predicted 456
2 SASI_Mm01_00252430 predicted 751
3 SASI_Mm01_00252431 predicted 839
4 SASI_Mm01_00252432 predicted 462
5 SASI_Mm01_00252433 predicted 552
6 SASI_Mm01_00252434 predicted 742
7 SASI_Mm01_00252435 predicted 459
8 SASI_Mm01_00252436 predicted 550
9 SASI_Mm01_00252437 predicted 560
10 SASI_Mm01_00252438 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210518 predicted 5667
2 SASI_Mm01_00210519 predicted 3770
3 SASI_Mm01_00210520 predicted 2198
4 SASI_Mm01_00210521 predicted 2460
5 SASI_Mm01_00210522 predicted 1352
6 SASI_Mm01_00210523 predicted 460
7 SASI_Mm01_00210524 predicted 3916
8 SASI_Mm01_00210525 predicted 1014
9 SASI_Mm01_00210526 predicted 965
10 SASI_Mm01_00210527 predicted 4445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153252
VALIDATED
BRWD3 MISSION shRNA Bacterial Glycerol Stock
bromodomain and WD repeat domain containing 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2234s21c1
Sequence:CCGGACAAGACCTGAGACTAATTAACTCGAGTTAATTAGTCTCAGGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-3416s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2357s21c1
Sequence:CCGGTCGAAGACATAGTAGTCAAATCTCGAGATTTGACTACTATGTCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-727s21c1
Sequence:CCGGGTAGTCGCTTTGGTCATATTTCTCGAGAAATATGACCAAAGCGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153252.3-5849s21c1
Sequence:CCGGTCAAATAAGCCTTACTCATTACTCGAGTAATGAGTAAGGCTTATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5895s1c1
Sequence:CCGGCCACACACACACAAACACATACTCGAGTATGTGTTTGTGTGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153252.2-5720s1c1
Sequence:CCGGGCAGGGAATTTACCAGGAAATCTCGAGATTTCCTGGTAAATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153252.2-5439s1c1
Sequence:CCGGGCACGTATTGCAGATGATGAACTCGAGTTCATCATCTGCAATACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5801s1c1
Sequence:CCGGGCCAGTATACATTTGTTTCAACTCGAGTTGAAACAAATGTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-4318s1c1
Sequence:CCGGGACAACAAGATTCATCTCTTTCTCGAGAAAGAGATGAATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-1445s1c1
Sequence:CCGGGCAACAAGAATGGAAGAGTATCTCGAGATACTCTTCCATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-4868s1c1
Sequence:CCGGCCCAGGGAAAGCCAAATCATTCTCGAGAATGATTTGGCTTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-5227s1c1
Sequence:CCGGGAAAGCAACATGGCAATGGAACTCGAGTTCCATTGCCATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153252
VALIDATED
BRWD3 MISSION shRNA shRNA Plasmid DNA
bromodomain and WD repeat domain containing 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2234s21c1
Sequence:CCGGACAAGACCTGAGACTAATTAACTCGAGTTAATTAGTCTCAGGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-3416s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2357s21c1
Sequence:CCGGTCGAAGACATAGTAGTCAAATCTCGAGATTTGACTACTATGTCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-727s21c1
Sequence:CCGGGTAGTCGCTTTGGTCATATTTCTCGAGAAATATGACCAAAGCGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153252.3-5849s21c1
Sequence:CCGGTCAAATAAGCCTTACTCATTACTCGAGTAATGAGTAAGGCTTATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5895s1c1
Sequence:CCGGCCACACACACACAAACACATACTCGAGTATGTGTTTGTGTGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153252.2-5720s1c1
Sequence:CCGGGCAGGGAATTTACCAGGAAATCTCGAGATTTCCTGGTAAATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153252.2-5439s1c1
Sequence:CCGGGCACGTATTGCAGATGATGAACTCGAGTTCATCATCTGCAATACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5801s1c1
Sequence:CCGGGCCAGTATACATTTGTTTCAACTCGAGTTGAAACAAATGTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-4318s1c1
Sequence:CCGGGACAACAAGATTCATCTCTTTCTCGAGAAAGAGATGAATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-1445s1c1
Sequence:CCGGGCAACAAGAATGGAAGAGTATCTCGAGATACTCTTCCATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-4868s1c1
Sequence:CCGGCCCAGGGAAAGCCAAATCATTCTCGAGAATGATTTGGCTTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-5227s1c1
Sequence:CCGGGAAAGCAACATGGCAATGGAACTCGAGTTCCATTGCCATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153252
VALIDATED
BRWD3 MISSION shRNA Lentiviral Transduction Particles
bromodomain and WD repeat domain containing 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2234s21c1
Sequence:CCGGACAAGACCTGAGACTAATTAACTCGAGTTAATTAGTCTCAGGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-3416s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-2357s21c1
Sequence:CCGGTCGAAGACATAGTAGTCAAATCTCGAGATTTGACTACTATGTCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153252.3-727s21c1
Sequence:CCGGGTAGTCGCTTTGGTCATATTTCTCGAGAAATATGACCAAAGCGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153252.3-5849s21c1
Sequence:CCGGTCAAATAAGCCTTACTCATTACTCGAGTAATGAGTAAGGCTTATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5895s1c1
Sequence:CCGGCCACACACACACAAACACATACTCGAGTATGTGTTTGTGTGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153252.2-5720s1c1
Sequence:CCGGGCAGGGAATTTACCAGGAAATCTCGAGATTTCCTGGTAAATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153252.2-5439s1c1
Sequence:CCGGGCACGTATTGCAGATGATGAACTCGAGTTCATCATCTGCAATACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153252.2-5801s1c1
Sequence:CCGGGCCAGTATACATTTGTTTCAACTCGAGTTGAAACAAATGTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-4318s1c1
Sequence:CCGGGACAACAAGATTCATCTCTTTCTCGAGAAAGAGATGAATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-1445s1c1
Sequence:CCGGGCAACAAGAATGGAAGAGTATCTCGAGATACTCTTCCATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153252.2-4868s1c1
Sequence:CCGGCCCAGGGAAAGCCAAATCATTCTCGAGAATGATTTGGCTTTCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153252.2-5227s1c1
Sequence:CCGGGAAAGCAACATGGCAATGGAACTCGAGTTCCATTGCCATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081477
BRWD3 MISSION shRNA Bacterial Glycerol Stock
bromodomain and WD repeat domain containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3926s21c1
Sequence:GTACCGGGATGTCCTACTTCGGTTTATTCTCGAGAATAAACCGAAGTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-5441s21c1
Sequence:CCGGAGTCGACTTCCACGGATTAAACTCGAGTTTAATCCGTGGAAGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3373s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-792s21c1
Sequence:CCGGATCGAAGCGGGAGGCGAATTTCTCGAGAAATTCGCCTCCCGCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-4831s21c1
Sequence:CCGGAGCCAAATCATTTCGTAATAGCTCGAGCTATTACGAAATGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3652s21c1
Sequence:CCGGTGAGGAGTGTGAACGAGTTATCTCGAGATAACTCGTTCACACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-1241s21c1
Sequence:CCGGGATCATGTAATTAGGATATACCTCGAGGTATATCCTAATTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3887s21c1
Sequence:CCGGCCAGATAGTCCCATAGTTAAACTCGAGTTTAACTATGGGACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081477.1-6102s21c1
Sequence:CCGGGATTCCTATGCCCAGTAATAACTCGAGTTATTACTGGGCATAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081477
BRWD3 MISSION shRNA shRNA Plasmid DNA
bromodomain and WD repeat domain containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3926s21c1
Sequence:GTACCGGGATGTCCTACTTCGGTTTATTCTCGAGAATAAACCGAAGTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-5441s21c1
Sequence:CCGGAGTCGACTTCCACGGATTAAACTCGAGTTTAATCCGTGGAAGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3373s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-792s21c1
Sequence:CCGGATCGAAGCGGGAGGCGAATTTCTCGAGAAATTCGCCTCCCGCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-4831s21c1
Sequence:CCGGAGCCAAATCATTTCGTAATAGCTCGAGCTATTACGAAATGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3652s21c1
Sequence:CCGGTGAGGAGTGTGAACGAGTTATCTCGAGATAACTCGTTCACACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-1241s21c1
Sequence:CCGGGATCATGTAATTAGGATATACCTCGAGGTATATCCTAATTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3887s21c1
Sequence:CCGGCCAGATAGTCCCATAGTTAAACTCGAGTTTAACTATGGGACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081477.1-6102s21c1
Sequence:CCGGGATTCCTATGCCCAGTAATAACTCGAGTTATTACTGGGCATAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081477
BRWD3 MISSION shRNA Lentiviral Transduction Particles
bromodomain and WD repeat domain containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3926s21c1
Sequence:GTACCGGGATGTCCTACTTCGGTTTATTCTCGAGAATAAACCGAAGTAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-5441s21c1
Sequence:CCGGAGTCGACTTCCACGGATTAAACTCGAGTTTAATCCGTGGAAGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3373s21c1
Sequence:CCGGTGATAGATTCCGCAGTATAATCTCGAGATTATACTGCGGAATCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-792s21c1
Sequence:CCGGATCGAAGCGGGAGGCGAATTTCTCGAGAAATTCGCCTCCCGCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-4831s21c1
Sequence:CCGGAGCCAAATCATTTCGTAATAGCTCGAGCTATTACGAAATGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3652s21c1
Sequence:CCGGTGAGGAGTGTGAACGAGTTATCTCGAGATAACTCGTTCACACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-1241s21c1
Sequence:CCGGGATCATGTAATTAGGATATACCTCGAGGTATATCCTAATTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081477.1-3887s21c1
Sequence:CCGGCCAGATAGTCCCATAGTTAAACTCGAGTTTAACTATGGGACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081477.1-6102s21c1
Sequence:CCGGGATTCCTATGCCCAGTAATAACTCGAGTTATTACTGGGCATAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks