EMAIL THIS PAGE TO A FRIEND

BSCL2

Berardinelli-Seip congenital lipodystrophy 2 (seipin)

85 Gene Product Result for
Synonyms: GNG3LG HMN5 SPG17
UniProtKB ID: Q96G97, G3XAE4, Q567S1, Q96SV1, Q9BSQ0
Gene ID:
Human(26580) Summary: This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
Mouse(14705) Bernardinelli-Seip congenital lipodystrophy 2 homolog (human)
Rat(361722) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
naked mole-rat(101726428) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
domestic guinea pig(100734242) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
sheep(101113634) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Domestic Rabbit(100339598) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Zebrafish(567403) Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
cow(513558) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Horse(100063764) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
domestic cat(101091148) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
dog(476054) Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032667 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019651 MISSION® esiRNA esiRNA targeting mouse Bscl2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122955 Rosetta Predictions human pricing
NM_032667 Rosetta Predictions human pricing
NM_001012171 Rosetta Predictions rat pricing
NM_008144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327567 predicted 677
2 SASI_Hs02_00327568 predicted 756
3 SASI_Hs02_00327569 predicted 602
4 SASI_Hs02_00327570 predicted 929
5 SASI_Hs02_00327571 predicted 1288
6 SASI_Hs02_00327572 predicted 646
7 SASI_Hs02_00327573 predicted 888
8 SASI_Hs02_00327574 predicted 704
9 SASI_Hs02_00327575 predicted 1061
10 SASI_Hs02_00327576 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208940 predicted 498
2 SASI_Hs01_00208941 predicted 583
3 SASI_Hs01_00208942 predicted 429
4 SASI_Hs01_00208943 predicted 753
5 SASI_Hs01_00208944 predicted 1106
6 SASI_Hs01_00208945 predicted 475
7 SASI_Hs01_00208946 predicted 717
8 SASI_Hs01_00208947 predicted 527
9 SASI_Hs01_00208948 predicted 877
10 SASI_Hs01_00208949 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032084 predicted 1051
2 SASI_Rn02_00200368 predicted 1340
3 SASI_Rn01_00032087 predicted 1269
4 SASI_Rn02_00200369 predicted 1051
5 SASI_Rn01_00032089 predicted 1124
6 SASI_Rn01_00032090 predicted 976
7 SASI_Rn02_00200370 predicted 1266
8 SASI_Rn01_00032091 predicted 1328
9 SASI_Rn02_00200371 predicted 1187
10 SASI_Rn02_00200372 predicted 1129
11 SASI_Rn01_00032085 predicted 568
12 SASI_Rn01_00032086 predicted 690
13 SASI_Rn01_00032088 predicted 670
14 SASI_Rn01_00032092 predicted 704
15 SASI_Rn01_00032093 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138730 predicted 1251
2 SASI_Mm01_00138731 predicted 759
3 SASI_Mm02_00313238 predicted 755
4 SASI_Mm01_00138732 predicted 672
5 SASI_Mm01_00138733 predicted 411
6 SASI_Mm01_00138734 predicted 527
7 SASI_Mm01_00138735 predicted 881
8 SASI_Mm01_00138736 predicted 692
9 SASI_Mm01_00138737 predicted 640
10 SASI_Mm01_00138738 predicted 970
11 SASI_Mm01_00138739 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008144
VALIDATED
BSCL2 MISSION shRNA Bacterial Glycerol Stock
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-706s1c1
Sequence:CCGGCGAGTCACCTTAGAGCTTGAACTCGAGTTCAAGCTCTAAGGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-758s1c1
Sequence:CCGGGCATGTTCTTAGTCACTGTTTCTCGAGAAACAGTGACTAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008144.3-928s1c1
Sequence:CCGGGTAGAACTCTACTCTGACTATCTCGAGATAGTCAGAGTAGAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-927s1c1
Sequence:CCGGAGTAGAACTCTACTCTGACTACTCGAGTAGTCAGAGTAGAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-1196s1c1
Sequence:CCGGTGCAGGTTAATATCCGACAAACTCGAGTTTGTCGGATATTAACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1306s21c1
Sequence:CCGGCATCGTGCTCTTCAGCTATATCTCGAGATATAGCTGAAGAGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-420s21c1
Sequence:CCGGCATGCAGAGACCAGATCAAAGCTCGAGCTTTGATCTGGTCTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-941s21c1
Sequence:CCGGTTAGTCACTGTTTCATGTTATCTCGAGATAACATGAAACAGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1104s21c1
Sequence:CCGGTAGAACTCTACTCTGACTATACTCGAGTATAGTCAGAGTAGAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-966s21c1
Sequence:CCGGGCCAACAACTGGAGCAATTATCTCGAGATAATTGCTCCAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-674s21c1
Sequence:CCGGGTGATCGGGTACTGATGTATGCTCGAGCATACATCAGTACCCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-1132s21c1
Sequence:CCGGATCGTGCTCTTCAGCTATATGCTCGAGCATATAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1361s21c1
Sequence:CCGGCGCTTCTCTCTGCAGGTTAATCTCGAGATTAACCTGCAGAGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008144
VALIDATED
BSCL2 MISSION shRNA shRNA Plasmid DNA
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-706s1c1
Sequence:CCGGCGAGTCACCTTAGAGCTTGAACTCGAGTTCAAGCTCTAAGGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-758s1c1
Sequence:CCGGGCATGTTCTTAGTCACTGTTTCTCGAGAAACAGTGACTAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008144.3-928s1c1
Sequence:CCGGGTAGAACTCTACTCTGACTATCTCGAGATAGTCAGAGTAGAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-927s1c1
Sequence:CCGGAGTAGAACTCTACTCTGACTACTCGAGTAGTCAGAGTAGAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-1196s1c1
Sequence:CCGGTGCAGGTTAATATCCGACAAACTCGAGTTTGTCGGATATTAACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1306s21c1
Sequence:CCGGCATCGTGCTCTTCAGCTATATCTCGAGATATAGCTGAAGAGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-420s21c1
Sequence:CCGGCATGCAGAGACCAGATCAAAGCTCGAGCTTTGATCTGGTCTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-941s21c1
Sequence:CCGGTTAGTCACTGTTTCATGTTATCTCGAGATAACATGAAACAGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1104s21c1
Sequence:CCGGTAGAACTCTACTCTGACTATACTCGAGTATAGTCAGAGTAGAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-966s21c1
Sequence:CCGGGCCAACAACTGGAGCAATTATCTCGAGATAATTGCTCCAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-674s21c1
Sequence:CCGGGTGATCGGGTACTGATGTATGCTCGAGCATACATCAGTACCCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-1132s21c1
Sequence:CCGGATCGTGCTCTTCAGCTATATGCTCGAGCATATAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1361s21c1
Sequence:CCGGCGCTTCTCTCTGCAGGTTAATCTCGAGATTAACCTGCAGAGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008144
VALIDATED
BSCL2 MISSION shRNA Lentiviral Transduction Particles
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-706s1c1
Sequence:CCGGCGAGTCACCTTAGAGCTTGAACTCGAGTTCAAGCTCTAAGGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-758s1c1
Sequence:CCGGGCATGTTCTTAGTCACTGTTTCTCGAGAAACAGTGACTAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008144.3-928s1c1
Sequence:CCGGGTAGAACTCTACTCTGACTATCTCGAGATAGTCAGAGTAGAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-927s1c1
Sequence:CCGGAGTAGAACTCTACTCTGACTACTCGAGTAGTCAGAGTAGAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008144.3-1196s1c1
Sequence:CCGGTGCAGGTTAATATCCGACAAACTCGAGTTTGTCGGATATTAACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1306s21c1
Sequence:CCGGCATCGTGCTCTTCAGCTATATCTCGAGATATAGCTGAAGAGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-420s21c1
Sequence:CCGGCATGCAGAGACCAGATCAAAGCTCGAGCTTTGATCTGGTCTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-941s21c1
Sequence:CCGGTTAGTCACTGTTTCATGTTATCTCGAGATAACATGAAACAGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1104s21c1
Sequence:CCGGTAGAACTCTACTCTGACTATACTCGAGTATAGTCAGAGTAGAGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-966s21c1
Sequence:CCGGGCCAACAACTGGAGCAATTATCTCGAGATAATTGCTCCAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-674s21c1
Sequence:CCGGGTGATCGGGTACTGATGTATGCTCGAGCATACATCAGTACCCGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.3-1132s21c1
Sequence:CCGGATCGTGCTCTTCAGCTATATGCTCGAGCATATAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008144.4-1361s21c1
Sequence:CCGGCGCTTCTCTCTGCAGGTTAATCTCGAGATTAACCTGCAGAGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032667
VALIDATED
BSCL2 MISSION shRNA Bacterial Glycerol Stock
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1019s1c1
Sequence:CCGGCCTGCTATACAACTTCCCGATCTCGAGATCGGGAAGTTGTATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-493s1c1
Sequence:CCGGGCTCCTTCTACTATTCCTATACTCGAGTATAGGAATAGTAGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1142s1c1
Sequence:CCGGCCGCTTCTCTTTGCAGGTTAACTCGAGTTAACCTGCAAAGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-754s1c1
Sequence:CCGGGCCGAATCATCTCCACTTCTTCTCGAGAAGAAGTGGAGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1007s1c1
Sequence:CCGGTGGGCTCAGATACCTGCTATACTCGAGTATAGCAGGTATCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-963s21c1
Sequence:CCGGATCGTGCTCTTCAGCTACATGCTCGAGCATGTAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-800s21c1
Sequence:CCGGGACCACTGGAGCGATCATTGACTCGAGTCAATGATCGCTCCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-760s21c1
Sequence:CCGGTGGAACTCTACGCAGACTATACTCGAGTATAGTCTGCGTAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-477s21c1
Sequence:CCGGGCCAATGTCTCGCTGACTAAGCTCGAGCTTAGTCAGCGAGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-524s21c1
Sequence:CCGGTGGACAGCCGTATCGTGTTACCTCGAGGTAACACGATACGGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-915s21c1
Sequence:CCGGACCTGCGCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-589s21c1
Sequence:CCGGGCATGTTCTTGGTCACCATTTCTCGAGAAATGGTGACCAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-1114s21c1
Sequence:CCGGAGGAGTCAACTCCGCAATCAGCTCGAGCTGATTGCGGAGTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-651s21c1
Sequence:CCGGCGTTCGGTGATGCTGCATTACCTCGAGGTAATGCAGCATCACCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-709s21c1
Sequence:CCGGTCTCTAGCCTCCTGCTATTTGCTCGAGCAAATAGCAGGAGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032667
VALIDATED
BSCL2 MISSION shRNA shRNA Plasmid DNA
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1019s1c1
Sequence:CCGGCCTGCTATACAACTTCCCGATCTCGAGATCGGGAAGTTGTATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-493s1c1
Sequence:CCGGGCTCCTTCTACTATTCCTATACTCGAGTATAGGAATAGTAGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1142s1c1
Sequence:CCGGCCGCTTCTCTTTGCAGGTTAACTCGAGTTAACCTGCAAAGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-754s1c1
Sequence:CCGGGCCGAATCATCTCCACTTCTTCTCGAGAAGAAGTGGAGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1007s1c1
Sequence:CCGGTGGGCTCAGATACCTGCTATACTCGAGTATAGCAGGTATCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-963s21c1
Sequence:CCGGATCGTGCTCTTCAGCTACATGCTCGAGCATGTAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-800s21c1
Sequence:CCGGGACCACTGGAGCGATCATTGACTCGAGTCAATGATCGCTCCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-760s21c1
Sequence:CCGGTGGAACTCTACGCAGACTATACTCGAGTATAGTCTGCGTAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-477s21c1
Sequence:CCGGGCCAATGTCTCGCTGACTAAGCTCGAGCTTAGTCAGCGAGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-524s21c1
Sequence:CCGGTGGACAGCCGTATCGTGTTACCTCGAGGTAACACGATACGGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-915s21c1
Sequence:CCGGACCTGCGCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-589s21c1
Sequence:CCGGGCATGTTCTTGGTCACCATTTCTCGAGAAATGGTGACCAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-1114s21c1
Sequence:CCGGAGGAGTCAACTCCGCAATCAGCTCGAGCTGATTGCGGAGTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-651s21c1
Sequence:CCGGCGTTCGGTGATGCTGCATTACCTCGAGGTAATGCAGCATCACCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-709s21c1
Sequence:CCGGTCTCTAGCCTCCTGCTATTTGCTCGAGCAAATAGCAGGAGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032667
VALIDATED
BSCL2 MISSION shRNA Lentiviral Transduction Particles
Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1019s1c1
Sequence:CCGGCCTGCTATACAACTTCCCGATCTCGAGATCGGGAAGTTGTATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-493s1c1
Sequence:CCGGGCTCCTTCTACTATTCCTATACTCGAGTATAGGAATAGTAGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1142s1c1
Sequence:CCGGCCGCTTCTCTTTGCAGGTTAACTCGAGTTAACCTGCAAAGAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-754s1c1
Sequence:CCGGGCCGAATCATCTCCACTTCTTCTCGAGAAGAAGTGGAGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032667.4-1007s1c1
Sequence:CCGGTGGGCTCAGATACCTGCTATACTCGAGTATAGCAGGTATCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-963s21c1
Sequence:CCGGATCGTGCTCTTCAGCTACATGCTCGAGCATGTAGCTGAAGAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-800s21c1
Sequence:CCGGGACCACTGGAGCGATCATTGACTCGAGTCAATGATCGCTCCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-760s21c1
Sequence:CCGGTGGAACTCTACGCAGACTATACTCGAGTATAGTCTGCGTAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-477s21c1
Sequence:CCGGGCCAATGTCTCGCTGACTAAGCTCGAGCTTAGTCAGCGAGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032667.5-524s21c1
Sequence:CCGGTGGACAGCCGTATCGTGTTACCTCGAGGTAACACGATACGGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-915s21c1
Sequence:CCGGACCTGCGCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-589s21c1
Sequence:CCGGGCATGTTCTTGGTCACCATTTCTCGAGAAATGGTGACCAAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-1114s21c1
Sequence:CCGGAGGAGTCAACTCCGCAATCAGCTCGAGCTGATTGCGGAGTTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-651s21c1
Sequence:CCGGCGTTCGGTGATGCTGCATTACCTCGAGGTAATGCAGCATCACCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032667.5-709s21c1
Sequence:CCGGTCTCTAGCCTCCTGCTATTTGCTCGAGCAAATAGCAGGAGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks