EMAIL THIS PAGE TO A FRIEND

BSDC1

BSD domain containing 1

164 Gene Product Result for
Gene ID:
Mouse(100383) BSD domain containing 1
Rat(297890) BSD domain containing 1
Zebrafish(794882) BSD domain containing 1
cow(505545) BSD domain containing 1
Horse(100055839) BSD domain containing 1
domestic cat(101099644) BSD domain containing 1
dog(487307) BSD domain containing 1
chicken(419658) BSD domain containing 1
sheep(101113659) BSD domain containing 1
Domestic Rabbit(100354072) BSD domain containing 1
domestic guinea pig(100730641) BSD domain containing 1
naked mole-rat(101716154) BSD domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42507 Anti-BSDC1 antibody produced in rabbit IgG fraction of antiserum rabbit, zebrafish, mouse, guinea pig, rat, canine, horse, human, bovine
immunohistochemistry, western blot pricing
HPA031358 Anti-BSDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA031360 Anti-BSDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018045 Rosetta Predictions human pricing
NM_001106636 Rosetta Predictions rat pricing
NM_133889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034490 predicted 1214
2 SASI_Hs01_00034491 predicted 939
3 SASI_Hs01_00034492 predicted 247
4 SASI_Hs02_00351166 predicted 873
5 SASI_Hs01_00034494 predicted 741
6 SASI_Hs01_00034495 predicted 574
7 SASI_Hs02_00351167 predicted 1348
8 SASI_Hs01_00034496 predicted 349
9 SASI_Hs01_00034497 predicted 1167
10 SASI_Hs02_00351168 predicted 874
11 SASI_Hs01_00034493 predicted 1363
12 SASI_Hs01_00034498 predicted 1284
13 SASI_Hs01_00034499 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220898 predicted 1199
2 SASI_Rn02_00220899 predicted 1081
3 SASI_Rn02_00220900 predicted 1065
4 SASI_Rn02_00220901 predicted 1201
5 SASI_Rn02_00220902 predicted 706
6 SASI_Rn02_00220903 predicted 493
7 SASI_Rn02_00220904 predicted 1505
8 SASI_Rn02_00220905 predicted 247
9 SASI_Rn02_00220906 predicted 575
10 SASI_Rn02_00220907 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102595 predicted 312
2 SASI_Mm01_00102596 predicted 1560
3 SASI_Mm01_00102597 predicted 1063
4 SASI_Mm01_00102598 predicted 564
5 SASI_Mm01_00102599 predicted 1574
6 SASI_Mm02_00338946 predicted 1769
7 SASI_Mm01_00102600 predicted 698
8 SASI_Mm02_00338947 predicted 485
9 SASI_Mm01_00102601 predicted 1497
10 SASI_Mm01_00102603 predicted 1130
11 SASI_Mm01_00102602 predicted 937
12 SASI_Mm01_00102604 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133889
VALIDATED
BSDC1 MISSION shRNA Bacterial Glycerol Stock
BSD domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-647s21c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-1205s21c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133889.2-1510s21c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-303s21c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-647s1c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-1510s1c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-1205s1c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-303s1c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133889
VALIDATED
BSDC1 MISSION shRNA shRNA Plasmid DNA
BSD domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-647s21c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-1205s21c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133889.2-1510s21c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-303s21c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-647s1c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-1510s1c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-1205s1c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-303s1c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133889
VALIDATED
BSDC1 MISSION shRNA Lentiviral Transduction Particles
BSD domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-647s21c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-1205s21c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133889.2-1510s21c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133889.2-303s21c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-647s1c1
Sequence:CCGGGCAGACCAGAGTATCTCTGAACTCGAGTTCAGAGATACTCTGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133889.2-1510s1c1
Sequence:CCGGGCCAACCTTAGGATGACCTAACTCGAGTTAGGTCATCCTAAGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-1205s1c1
Sequence:CCGGGACTTGGACATGACTGAAGAACTCGAGTTCTTCAGTCATGTCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133889.2-303s1c1
Sequence:CCGGCCATCGACTGTGATGTCATCACTCGAGTGATGACATCACAGTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018045
VALIDATED
BSDC1 MISSION shRNA Bacterial Glycerol Stock
BSD domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-622s21c1
Sequence:CCGGTGGCATCGGTATTTCTATAAACTCGAGTTTATAGAAATACCGATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1342s21c1
Sequence:CCGGTCAGAGGGAAGCGAGCCTAATCTCGAGATTAGGCTCGCTTCCCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-277s21c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018045.5-1793s21c1
Sequence:CCGGGGTATGAGGCCTGAGTATATACTCGAGTATATACTCAGGCCTCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1148s21c1
Sequence:CCGGCCACAGACTTACGGGTGTTTGCTCGAGCAAACACCCGTAAGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-185s1c1
Sequence:CCGGGTCAAGGAGAAGCTGGCTATTCTCGAGAATAGCCAGCTTCTCCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018045.4-1569s1c1
Sequence:CCGGCCTGAGAAACTGCTTAAGAAACTCGAGTTTCTTAAGCAGTTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-3364s1c1
Sequence:CCGGGCCAACAATAGGATGACCCAACTCGAGTTGGGTCATCCTATTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-278s1c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018045.4-1199s1c1
Sequence:CCGGCCCTCCAACAATGGAAAGAAACTCGAGTTTCTTTCCATTGTTGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018045
VALIDATED
BSDC1 MISSION shRNA shRNA Plasmid DNA
BSD domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-622s21c1
Sequence:CCGGTGGCATCGGTATTTCTATAAACTCGAGTTTATAGAAATACCGATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1342s21c1
Sequence:CCGGTCAGAGGGAAGCGAGCCTAATCTCGAGATTAGGCTCGCTTCCCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-277s21c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018045.5-1793s21c1
Sequence:CCGGGGTATGAGGCCTGAGTATATACTCGAGTATATACTCAGGCCTCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1148s21c1
Sequence:CCGGCCACAGACTTACGGGTGTTTGCTCGAGCAAACACCCGTAAGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-185s1c1
Sequence:CCGGGTCAAGGAGAAGCTGGCTATTCTCGAGAATAGCCAGCTTCTCCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018045.4-1569s1c1
Sequence:CCGGCCTGAGAAACTGCTTAAGAAACTCGAGTTTCTTAAGCAGTTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-3364s1c1
Sequence:CCGGGCCAACAATAGGATGACCCAACTCGAGTTGGGTCATCCTATTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-278s1c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018045.4-1199s1c1
Sequence:CCGGCCCTCCAACAATGGAAAGAAACTCGAGTTTCTTTCCATTGTTGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018045
VALIDATED
BSDC1 MISSION shRNA Lentiviral Transduction Particles
BSD domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-622s21c1
Sequence:CCGGTGGCATCGGTATTTCTATAAACTCGAGTTTATAGAAATACCGATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1342s21c1
Sequence:CCGGTCAGAGGGAAGCGAGCCTAATCTCGAGATTAGGCTCGCTTCCCTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018045.5-277s21c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018045.5-1793s21c1
Sequence:CCGGGGTATGAGGCCTGAGTATATACTCGAGTATATACTCAGGCCTCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018045.5-1148s21c1
Sequence:CCGGCCACAGACTTACGGGTGTTTGCTCGAGCAAACACCCGTAAGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-185s1c1
Sequence:CCGGGTCAAGGAGAAGCTGGCTATTCTCGAGAATAGCCAGCTTCTCCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018045.4-1569s1c1
Sequence:CCGGCCTGAGAAACTGCTTAAGAAACTCGAGTTTCTTAAGCAGTTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-3364s1c1
Sequence:CCGGGCCAACAATAGGATGACCCAACTCGAGTTGGGTCATCCTATTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018045.4-278s1c1
Sequence:CCGGGAGAAGATGAAGAAAGGGTTACTCGAGTAACCCTTTCTTCATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018045.4-1199s1c1
Sequence:CCGGCCCTCCAACAATGGAAAGAAACTCGAGTTTCTTTCCATTGTTGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)