EMAIL THIS PAGE TO A FRIEND

BSG

basigin (Ok blood group)

126 Gene Product Result for
Synonyms: 5F7 CD147 EMMPRIN M6 OK TCSF
UniProtKB ID: P35613, A6NJW1, D3YLG5, Q7Z796, Q8IZL7
Gene ID:
Human(682) Summary: The protein encoded by this gene is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. The encoded protein is also a member of the immunoglobulin superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12215) basigin
Rat(25246) basigin (Ok blood group)
domestic cat(101090746) basigin (Ok blood group)
cow(508716) basigin (Ok blood group)
Horse(100049616) basigin (Ok blood group)
dog(476758) basigin (Ok blood group)
chicken(770363) basigin (Ok blood group)
sheep(101114353) basigin (Ok blood group)
Domestic Rabbit(100009229) basigin (Ok blood group)
naked mole-rat(101720876) basigin (Ok blood group)
domestic guinea pig(100720467) basigin (Ok blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105278 Anti-BSG (186-200) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105279 Anti-BSG (371-385) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1405523 Anti-BSG antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA036048 Anti-BSG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA074870 Anti-BSG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4502896 Anti-CD147, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
E4029 Anti-EMMPRIN antibody produced in goat affinity isolated antibody human
western blot pricing
E4154 Anti-EMMPRIN antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
SAB4100147 Monoclonal Anti-BSG antibody produced in mouse clone BSG-A114, culture supernatant human
western blot pricing
SAB4100148 Monoclonal Anti-BSG antibody produced in mouse clone BSG-B114, culture supernatant human
western blot pricing
SAB4700021 Monoclonal Anti-CD147 antibody produced in mouse clone MEM-M6/2, purified immunoglobulin, buffered aqueous solution pig, human
flow cytometry pricing
SAB4700022 Monoclonal Anti-CD147 antibody produced in mouse clone MEM-M6/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700027 Monoclonal Anti-CD147, low endotoxin antibody produced in mouse clone MEM-M6/6, purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4700023 Monoclonal Anti-CD147-APC antibody produced in mouse clone MEM-M6/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700024 Monoclonal Anti-CD147-Biotin antibody produced in mouse clone MEM-M6/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700025 Monoclonal Anti-CD147-FITC antibody produced in mouse clone MEM-M6/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700026 Monoclonal Anti-CD147-PE antibody produced in mouse clone MEM-M6/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1322 Human CD147 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001728 Rosetta Predictions human pricing
NM_198589 Rosetta Predictions human pricing
NM_198590 Rosetta Predictions human pricing
NM_198591 Rosetta Predictions human pricing
NM_001109882 Rosetta Predictions rat pricing
NM_012783 Rosetta Predictions rat pricing
NM_001077184 Rosetta Predictions mouse pricing
NM_009768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156881 predicted 888
2 SASI_Hs01_00156882 predicted 933
3 SASI_Hs01_00156883 predicted 1572
4 SASI_Hs01_00156885 predicted 1414
5 SASI_Hs01_00156886 predicted 1324
6 SASI_Hs01_00156887 predicted 1561
7 SASI_Hs01_00156888 predicted 901
8 SASI_Hs01_00156889 predicted 1722
9 SASI_Hs01_00156890 predicted 1498
10 SASI_Hs02_00332432 predicted 1724
11 SASI_Hs01_00156884 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026941 predicted 543
2 SASI_Hs01_00026942 predicted 585
3 SASI_Hs01_00026943 predicted 1224
4 SASI_Hs01_00026945 predicted 1071
5 SASI_Hs01_00026946 predicted 984
6 SASI_Hs01_00026947 predicted 1209
7 SASI_Hs01_00026948 predicted 554
8 SASI_Hs01_00026949 predicted 1373
9 SASI_Hs01_00026950 predicted 1152
10 SASI_Hs02_00372238 predicted 1375
11 SASI_Hs01_00026944 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072905 predicted 641
2 SASI_Hs01_00072906 predicted 684
3 SASI_Hs01_00072907 predicted 1316
4 SASI_Hs01_00072908 predicted 1386
5 SASI_Hs01_00072909 predicted 1159
6 SASI_Hs01_00072910 predicted 1078
7 SASI_Hs01_00072911 predicted 1301
8 SASI_Hs01_00072912 predicted 656
9 SASI_Hs01_00072913 predicted 1471
10 SASI_Hs01_00072914 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226125 predicted 471
2 SASI_Hs01_00226126 predicted 526
3 SASI_Hs01_00226127 predicted 1156
4 SASI_Hs01_00226129 predicted 1005
5 SASI_Hs01_00226130 predicted 910
6 SASI_Hs01_00226131 predicted 1142
7 SASI_Hs01_00226132 predicted 493
8 SASI_Hs01_00226133 predicted 1308
9 SASI_Hs01_00226134 predicted 1078
10 SASI_Hs02_00372239 predicted 1312
11 SASI_Hs01_00226128 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250672 predicted 1389
2 SASI_Rn02_00250673 predicted 901
3 SASI_Rn02_00250674 predicted 878
4 SASI_Rn02_00250675 predicted 908
5 SASI_Rn02_00250676 predicted 901
6 SASI_Rn02_00250677 predicted 836
7 SASI_Rn02_00250678 predicted 1387
8 SASI_Rn02_00250679 predicted 1099
9 SASI_Rn02_00250680 predicted 749
10 SASI_Rn02_00250681 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260187 predicted 1037
2 SASI_Rn01_00041135 predicted 552
3 SASI_Rn01_00041136 predicted 527
4 SASI_Rn01_00041138 predicted 556
5 SASI_Rn01_00041139 predicted 556
6 SASI_Rn01_00041140 predicted 495
7 SASI_Rn01_00041141 predicted 1043
8 SASI_Rn01_00041143 predicted 757
9 SASI_Rn02_00260188 predicted 408
10 SASI_Rn01_00041144 predicted 486
11 SASI_Rn01_00041137 predicted 215
12 SASI_Rn01_00041142 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292372 predicted 916
2 SASI_Mm02_00292373 predicted 1110
3 SASI_Mm02_00292374 predicted 676
4 SASI_Mm02_00292375 predicted 649
5 SASI_Mm02_00292376 predicted 1027
6 SASI_Mm02_00292377 predicted 678
7 SASI_Mm02_00292378 predicted 540
8 SASI_Mm02_00292379 predicted 562
9 SASI_Mm02_00292380 predicted 479
10 SASI_Mm02_00292381 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316965 predicted 1263
2 SASI_Mm02_00316966 predicted 1460
3 SASI_Mm02_00316967 predicted 1021
4 SASI_Mm02_00316968 predicted 996
5 SASI_Mm02_00316969 predicted 1378
6 SASI_Mm02_00316970 predicted 1032
7 SASI_Mm02_00316971 predicted 895
8 SASI_Mm02_00316972 predicted 910
9 SASI_Mm01_00087433 predicted 827
10 SASI_Mm01_00087434 predicted 1409
11 SASI_Mm01_00087430 predicted 770
12 SASI_Mm01_00087431 predicted 767
13 SASI_Mm01_00087432 predicted 476
14 SASI_Mm01_00087435 predicted 1313
15 SASI_Mm01_00087436 predicted 536
16 SASI_Mm01_00087437 predicted 700
17 SASI_Mm01_00087438 predicted 1135
18 SASI_Mm01_00087439 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009768
VALIDATED
BSG MISSION shRNA Bacterial Glycerol Stock
basigin (Ok blood group)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1310s1c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1035s1c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-817s1c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-570s1c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-762s1c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009768.2-1452s21c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-904s21c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-1177s21c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-959s21c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-712s21c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009768
VALIDATED
BSG MISSION shRNA shRNA Plasmid DNA
basigin (Ok blood group)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1310s1c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1035s1c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-817s1c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-570s1c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-762s1c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009768.2-1452s21c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-904s21c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-1177s21c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-959s21c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-712s21c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009768
VALIDATED
BSG MISSION shRNA Lentiviral Transduction Particles
basigin (Ok blood group)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1310s1c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-1035s1c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009768.1-817s1c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-570s1c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009768.1-762s1c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009768.2-1452s21c1
Sequence:CCGGCCAAGTGAAGACAGAGCCTTACTCGAGTAAGGCTCTGTCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-904s21c1
Sequence:CCGGCCCTCCTATTACAGATTGGTTCTCGAGAACCAATCTGTAATAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-1177s21c1
Sequence:CCGGCCTGGTGTTGGTTACCATCATCTCGAGATGATGGTAACCAACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-959s21c1
Sequence:CCGGGCAATCACCAATAGCACTGAACTCGAGTTCAGTGCTATTGGTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009768.2-712s21c1
Sequence:CCGGCGACCTGCATACGAAGTACATCTCGAGATGTACTTCGTATGCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001728
VALIDATED
BSG MISSION shRNA Bacterial Glycerol Stock
basigin (Ok blood group)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001728.2-1372s1c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-519s1c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-776s1c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001728.2-1211s1c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-950s1c1
Sequence:CCGGGCTACACATTGAGAACCTGAACTCGAGTTCAGGTTCTCAATGTGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-519s21c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-776s21c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001728.2-1372s21c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-1211s21c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001728
VALIDATED
BSG MISSION shRNA shRNA Plasmid DNA
basigin (Ok blood group)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001728.2-1372s1c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-519s1c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-776s1c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001728.2-1211s1c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-950s1c1
Sequence:CCGGGCTACACATTGAGAACCTGAACTCGAGTTCAGGTTCTCAATGTGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-519s21c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-776s21c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001728.2-1372s21c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-1211s21c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001728
VALIDATED
BSG MISSION shRNA Lentiviral Transduction Particles
basigin (Ok blood group)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001728.2-1372s1c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-519s1c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-776s1c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001728.2-1211s1c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001728.2-950s1c1
Sequence:CCGGGCTACACATTGAGAACCTGAACTCGAGTTCAGGTTCTCAATGTGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-519s21c1
Sequence:CCGGACAGTCTTCACTACCGTAGAACTCGAGTTCTACGGTAGTGAAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-776s21c1
Sequence:CCGGGAAGTCGTCAGAACACATCAACTCGAGTTGATGTGTTCTGACGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001728.2-1372s21c1
Sequence:CCGGCCCATCATACACTTCCTTCTTCTCGAGAAGAAGGAAGTGTATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001728.2-1211s21c1
Sequence:CCGGCCAGAATGACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)