EMAIL THIS PAGE TO A FRIEND

BSN

bassoon presynaptic cytomatrix protein

159 Gene Product Result for
Synonyms: ZNF231
UniProtKB ID: Q9UPA5, O43161, Q7LGH3
Gene ID:
Human(8927) Summary: Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
Mouse(12217) bassoon
Rat(29138) bassoon (presynaptic cytomatrix protein)
chicken(430723) bassoon (presynaptic cytomatrix protein)
dog(484769) bassoon (presynaptic cytomatrix protein)
Horse(100062814) bassoon (presynaptic cytomatrix protein)
cow(522724) bassoon (presynaptic cytomatrix protein)
domestic cat(101085610) bassoon (presynaptic cytomatrix protein)
naked mole-rat(101715247) bassoon presynaptic cytomatrix protein
domestic guinea pig(100730218) bassoon presynaptic cytomatrix protein
sheep(101117454) bassoon (presynaptic cytomatrix protein)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003458 Rosetta Predictions human pricing
NM_019146 Rosetta Predictions rat pricing
NM_007567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335704 predicted 5273
2 SASI_Hs02_00335705 predicted 4763
3 SASI_Hs01_00083292 predicted 3797
4 SASI_Hs01_00083293 predicted 4770
5 SASI_Hs01_00083294 predicted 1258
6 SASI_Hs01_00083295 predicted 687
7 SASI_Hs01_00083296 predicted 5193
8 SASI_Hs01_00083297 predicted 4389
9 SASI_Hs01_00083298 predicted 2930
10 SASI_Hs01_00083299 predicted 2528
11 SASI_Hs01_00083290 predicted 6155
12 SASI_Hs01_00083291 predicted 10230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042312 predicted 10475
2 SASI_Rn01_00042313 predicted 4730
3 SASI_Rn01_00042314 predicted 7745
4 SASI_Rn02_00261915 predicted 5143
5 SASI_Rn01_00042317 predicted 4176
6 SASI_Rn01_00042318 predicted 5769
7 SASI_Rn01_00042319 predicted 4081
8 SASI_Rn01_00042320 predicted 660
9 SASI_Rn02_00261916 predicted 3042
10 SASI_Rn01_00042321 predicted 1446
11 SASI_Rn01_00042315 predicted 2908
12 SASI_Rn01_00042316 predicted 12021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065736 predicted 10539
2 SASI_Mm01_00065737 predicted 9829
3 SASI_Mm02_00311940 predicted 6802
4 SASI_Mm02_00311941 predicted 10350
5 SASI_Mm01_00065739 predicted 6070
6 SASI_Mm01_00065740 predicted 5524
7 SASI_Mm01_00065741 predicted 3853
8 SASI_Mm01_00065742 predicted 6222
9 SASI_Mm01_00065743 predicted 9705
10 SASI_Mm01_00065745 predicted 5906
11 SASI_Mm01_00065738 predicted 4133
12 SASI_Mm01_00065744 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007567
BSN MISSION shRNA Bacterial Glycerol Stock
bassoon presynaptic cytomatrix protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-254s1c1
Sequence:CCGGGCCAGAGAACAACTTCTCCAACTCGAGTTGGAGAAGTTGTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-9499s1c1
Sequence:CCGGCCCACCAATTACGAGGTGATTCTCGAGAATCACCTCGTAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-6200s1c1
Sequence:CCGGGCTCAGTGTCAAACATCTATTCTCGAGAATAGATGTTTGACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-4545s1c1
Sequence:CCGGCCTAACGCTTTCCTCTGACATCTCGAGATGTCAGAGGAAAGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-5146s1c1
Sequence:CCGGCCTTTGGTTATCAACCTCAATCTCGAGATTGAGGTTGATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007567
BSN MISSION shRNA shRNA Plasmid DNA
bassoon presynaptic cytomatrix protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-254s1c1
Sequence:CCGGGCCAGAGAACAACTTCTCCAACTCGAGTTGGAGAAGTTGTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-9499s1c1
Sequence:CCGGCCCACCAATTACGAGGTGATTCTCGAGAATCACCTCGTAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-6200s1c1
Sequence:CCGGGCTCAGTGTCAAACATCTATTCTCGAGAATAGATGTTTGACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-4545s1c1
Sequence:CCGGCCTAACGCTTTCCTCTGACATCTCGAGATGTCAGAGGAAAGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-5146s1c1
Sequence:CCGGCCTTTGGTTATCAACCTCAATCTCGAGATTGAGGTTGATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007567
BSN MISSION shRNA Lentiviral Transduction Particles
bassoon presynaptic cytomatrix protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-254s1c1
Sequence:CCGGGCCAGAGAACAACTTCTCCAACTCGAGTTGGAGAAGTTGTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-9499s1c1
Sequence:CCGGCCCACCAATTACGAGGTGATTCTCGAGAATCACCTCGTAATTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-6200s1c1
Sequence:CCGGGCTCAGTGTCAAACATCTATTCTCGAGAATAGATGTTTGACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-4545s1c1
Sequence:CCGGCCTAACGCTTTCCTCTGACATCTCGAGATGTCAGAGGAAAGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007567.1-5146s1c1
Sequence:CCGGCCTTTGGTTATCAACCTCAATCTCGAGATTGAGGTTGATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003458
BSN MISSION shRNA Bacterial Glycerol Stock
bassoon presynaptic cytomatrix protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12303s1c1
Sequence:CCGGCGTGCGTTATACACAGAGTTTCTCGAGAAACTCTGTGTATAACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-1265s1c1
Sequence:CCGGCCTAAGATCGTCTTCAATGATCTCGAGATCATTGAAGACGATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003458.1-15512s1c1
Sequence:CCGGCGTGAGATATTGTATGTGTATCTCGAGATACACATACAATATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-9800s1c1
Sequence:CCGGCGAAACTACGTAATGATTGATCTCGAGATCAATCATTACGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-11633s1c1
Sequence:CCGGGAACAGACAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-6906s1c1
Sequence:CCGGCAAGTAGATTTCCCATTGCTTCTCGAGAAGCAATGGGAAATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12779s1c1
Sequence:CCGGCCAGTTTGATTTACGTGTATACTCGAGTATACACGTAAATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003458
BSN MISSION shRNA shRNA Plasmid DNA
bassoon presynaptic cytomatrix protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12303s1c1
Sequence:CCGGCGTGCGTTATACACAGAGTTTCTCGAGAAACTCTGTGTATAACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-1265s1c1
Sequence:CCGGCCTAAGATCGTCTTCAATGATCTCGAGATCATTGAAGACGATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003458.1-15512s1c1
Sequence:CCGGCGTGAGATATTGTATGTGTATCTCGAGATACACATACAATATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-9800s1c1
Sequence:CCGGCGAAACTACGTAATGATTGATCTCGAGATCAATCATTACGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-11633s1c1
Sequence:CCGGGAACAGACAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-6906s1c1
Sequence:CCGGCAAGTAGATTTCCCATTGCTTCTCGAGAAGCAATGGGAAATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12779s1c1
Sequence:CCGGCCAGTTTGATTTACGTGTATACTCGAGTATACACGTAAATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003458
BSN MISSION shRNA Lentiviral Transduction Particles
bassoon presynaptic cytomatrix protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12303s1c1
Sequence:CCGGCGTGCGTTATACACAGAGTTTCTCGAGAAACTCTGTGTATAACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-1265s1c1
Sequence:CCGGCCTAAGATCGTCTTCAATGATCTCGAGATCATTGAAGACGATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003458.1-15512s1c1
Sequence:CCGGCGTGAGATATTGTATGTGTATCTCGAGATACACATACAATATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-9800s1c1
Sequence:CCGGCGAAACTACGTAATGATTGATCTCGAGATCAATCATTACGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-11633s1c1
Sequence:CCGGGAACAGACAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003458.1-6906s1c1
Sequence:CCGGCAAGTAGATTTCCCATTGCTTCTCGAGAAGCAATGGGAAATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003458.1-12779s1c1
Sequence:CCGGCCAGTTTGATTTACGTGTATACTCGAGTATACACGTAAATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks