EMAIL THIS PAGE TO A FRIEND

BSND

Bartter syndrome, infantile, with sensorineural deafness (Barttin)

71 Gene Product Result for
Synonyms: BART DFNB73
UniProtKB ID: Q8WZ55, Q6NT28
Gene ID:
Human(7809) Summary: This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
Mouse(140475) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Rat(192675) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Zebrafish(497323) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
dog(100683039) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
cow(615670) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
domestic cat(101098972) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
chicken(424663) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
sheep(101123422) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Domestic Rabbit(100009026) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
domestic guinea pig(100731810) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
naked mole-rat(101702314) Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_057176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051981 MISSION® esiRNA esiRNA human BSND (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057176 Rosetta Predictions human pricing
NM_138979 Rosetta Predictions rat pricing
NM_080458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152903 predicted 335
2 SASI_Hs01_00152904 predicted 583
3 SASI_Hs01_00152905 predicted 421
4 SASI_Hs01_00152906 predicted 303
5 SASI_Hs01_00152907 predicted 586
6 SASI_Hs01_00152908 predicted 725
7 SASI_Hs01_00152909 predicted 948
8 SASI_Hs01_00152910 predicted 953
9 SASI_Hs01_00152911 predicted 610
10 SASI_Hs01_00152912 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091319 predicted 380
2 SASI_Rn01_00091320 predicted 695
3 SASI_Rn01_00091321 predicted 1083
4 SASI_Rn01_00091322 predicted 259
5 SASI_Rn02_00268412 predicted 1092
6 SASI_Rn01_00091324 predicted 754
7 SASI_Rn01_00091325 predicted 287
8 SASI_Rn02_00268413 predicted 700
9 SASI_Rn01_00091326 predicted 524
10 SASI_Rn01_00091327 predicted 524
11 SASI_Rn01_00091323 predicted 1320
12 SASI_Rn01_00091328 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091695 predicted 693
2 SASI_Mm01_00091696 predicted 875
3 SASI_Mm01_00091697 predicted 1211
4 SASI_Mm01_00091698 predicted 1239
5 SASI_Mm01_00091699 predicted 383
6 SASI_Mm01_00091700 predicted 522
7 SASI_Mm02_00338122 predicted 518
8 SASI_Mm02_00338123 predicted 706
9 SASI_Mm01_00091701 predicted 679
10 SASI_Mm01_00091703 predicted 1128
11 SASI_Mm01_00091702 predicted 397
12 SASI_Mm01_00091704 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080458
BSND MISSION shRNA Bacterial Glycerol Stock
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-869s1c1
Sequence:CCGGCTGGATCGCTTCAGTGACTTTCTCGAGAAAGTCACTGAAGCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1537s1c1
Sequence:CCGGGCTCAGTGTCTTTAGCAGTTTCTCGAGAAACTGCTAAAGACACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-358s1c1
Sequence:CCGGGTGCCAATGCTATCCTAAGATCTCGAGATCTTAGGATAGCATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1196s1c1
Sequence:CCGGCAAGTCCCAAACAGGATTGTACTCGAGTACAATCCTGTTTGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080458
BSND MISSION shRNA shRNA Plasmid DNA
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-869s1c1
Sequence:CCGGCTGGATCGCTTCAGTGACTTTCTCGAGAAAGTCACTGAAGCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1537s1c1
Sequence:CCGGGCTCAGTGTCTTTAGCAGTTTCTCGAGAAACTGCTAAAGACACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-358s1c1
Sequence:CCGGGTGCCAATGCTATCCTAAGATCTCGAGATCTTAGGATAGCATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1196s1c1
Sequence:CCGGCAAGTCCCAAACAGGATTGTACTCGAGTACAATCCTGTTTGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080458
BSND MISSION shRNA Lentiviral Transduction Particles
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-869s1c1
Sequence:CCGGCTGGATCGCTTCAGTGACTTTCTCGAGAAAGTCACTGAAGCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1537s1c1
Sequence:CCGGGCTCAGTGTCTTTAGCAGTTTCTCGAGAAACTGCTAAAGACACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080458.1-358s1c1
Sequence:CCGGGTGCCAATGCTATCCTAAGATCTCGAGATCTTAGGATAGCATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080458.1-1196s1c1
Sequence:CCGGCAAGTCCCAAACAGGATTGTACTCGAGTACAATCCTGTTTGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057176
BSND MISSION shRNA Bacterial Glycerol Stock
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057176.2-1220s1c1
Sequence:CCGGCGTAGCTTCTAGTCTGGAACTCTCGAGAGTTCCAGACTAGAAGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-573s1c1
Sequence:CCGGCCTGCCTGACTTCAGCCACATCTCGAGATGTGGCTGAAGTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-958s1c1
Sequence:CCGGCAAGACTTTGCCCTGATTGATCTCGAGATCAATCAGGGCAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-1114s1c1
Sequence:CCGGGAAGAGGAAGACCTGTACTATCTCGAGATAGTACAGGTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-443s1c1
Sequence:CCGGCTGACTTTCAAGGCATCCTCTCTCGAGAGAGGATGCCTTGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-338s21c1
Sequence:CCGGAGGTCTACGGCACCTTCTATGCTCGAGCATAGAAGGTGCCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-874s21c1
Sequence:CCGGCCCAATGCATCTCCACATGACCTCGAGGTCATGTGGAGATGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057176
BSND MISSION shRNA shRNA Plasmid DNA
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057176.2-1220s1c1
Sequence:CCGGCGTAGCTTCTAGTCTGGAACTCTCGAGAGTTCCAGACTAGAAGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-573s1c1
Sequence:CCGGCCTGCCTGACTTCAGCCACATCTCGAGATGTGGCTGAAGTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-958s1c1
Sequence:CCGGCAAGACTTTGCCCTGATTGATCTCGAGATCAATCAGGGCAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-1114s1c1
Sequence:CCGGGAAGAGGAAGACCTGTACTATCTCGAGATAGTACAGGTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-443s1c1
Sequence:CCGGCTGACTTTCAAGGCATCCTCTCTCGAGAGAGGATGCCTTGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-338s21c1
Sequence:CCGGAGGTCTACGGCACCTTCTATGCTCGAGCATAGAAGGTGCCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-874s21c1
Sequence:CCGGCCCAATGCATCTCCACATGACCTCGAGGTCATGTGGAGATGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057176
BSND MISSION shRNA Lentiviral Transduction Particles
Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057176.2-1220s1c1
Sequence:CCGGCGTAGCTTCTAGTCTGGAACTCTCGAGAGTTCCAGACTAGAAGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-573s1c1
Sequence:CCGGCCTGCCTGACTTCAGCCACATCTCGAGATGTGGCTGAAGTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-958s1c1
Sequence:CCGGCAAGACTTTGCCCTGATTGATCTCGAGATCAATCAGGGCAAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-1114s1c1
Sequence:CCGGGAAGAGGAAGACCTGTACTATCTCGAGATAGTACAGGTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057176.2-443s1c1
Sequence:CCGGCTGACTTTCAAGGCATCCTCTCTCGAGAGAGGATGCCTTGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-338s21c1
Sequence:CCGGAGGTCTACGGCACCTTCTATGCTCGAGCATAGAAGGTGCCGTAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057176.2-874s21c1
Sequence:CCGGCCCAATGCATCTCCACATGACCTCGAGGTCATGTGGAGATGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks