EMAIL THIS PAGE TO A FRIEND

BSPH1

binder of sperm protein homolog 1

39 Gene Product Result for
Synonyms: BSP1 ELSPBP2
UniProtKB ID: Q075Z2, A6NIZ5
Gene ID:
Mouse(330470) binder of sperm protein homolog 1
Rat(691820) binder of sperm protein homolog 1
naked mole-rat(101714151) binder of sperm protein homolog 1
domestic guinea pig(100733452) binder of sperm protein homolog 1
cow(100847317) binder of sperm protein homolog 1
domestic cat(101093063) binder of sperm protein homolog 1
dog(100684341) binder of sperm protein homolog 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128326 Rosetta Predictions human pricing
XM_001079751 Rosetta Predictions rat pricing
NM_001033418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331106 predicted 349
2 SASI_Hs02_00331107 predicted 285
3 SASI_Hs02_00331108 predicted 384
4 SASI_Hs02_00331109 predicted 358
5 SASI_Hs02_00331110 predicted 283
6 SASI_Hs02_00331111 predicted 285
7 SASI_Hs02_00331112 predicted 373
8 SASI_Hs02_00331113 predicted 384
9 SASI_Hs02_00331114 predicted 283
10 SASI_Hs02_00331115 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365338 predicted 237
2 SASI_Rn02_00365339 predicted 265
3 SASI_Rn02_00365340 predicted 262
4 SASI_Rn02_00365341 predicted 234
5 SASI_Rn02_00365342 predicted 241
6 SASI_Rn02_00365343 predicted 201
7 SASI_Rn02_00365344 predicted 226
8 SASI_Rn02_00365345 predicted 217
9 SASI_Rn02_00365346 predicted 258
10 SASI_Rn02_00365347 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150454 predicted 343
2 SASI_Mm01_00150455 predicted 447
3 SASI_Mm01_00150456 predicted 289
4 SASI_Mm01_00150457 predicted 194
5 SASI_Mm01_00150458 predicted 363
6 SASI_Mm01_00150459 predicted 300
7 SASI_Mm01_00150460 predicted 203
8 SASI_Mm01_00150463 predicted 338
9 SASI_Mm02_00288716 predicted 353
10 SASI_Mm02_00288717 predicted 506
11 SASI_Mm01_00150461 predicted 524
12 SASI_Mm01_00150462 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128326
BSPH1 MISSION shRNA Bacterial Glycerol Stock
binder of sperm protein homolog 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-224s21c1
Sequence:CCGGTGTCTTTCCATTCCACTATAACTCGAGTTATAGTGGAATGGAAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-139s21c1
Sequence:CCGGCTTGCATCTTCCCTGTTATTTCTCGAGAAATAACAGGGAAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-283s21c1
Sequence:CCGGGACACAAGTGGTGCTCGTTAACTCGAGTTAACGAGCACCACTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-179s21c1
Sequence:CCGGTGTGGAAACTATAACTCATTTCTCGAGAAATGAGTTATAGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-434s21c1
Sequence:CCGGGTGTTCACTGACCAAGAATTTCTCGAGAAATTCTTGGTCAGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128326
BSPH1 MISSION shRNA shRNA Plasmid DNA
binder of sperm protein homolog 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-224s21c1
Sequence:CCGGTGTCTTTCCATTCCACTATAACTCGAGTTATAGTGGAATGGAAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-139s21c1
Sequence:CCGGCTTGCATCTTCCCTGTTATTTCTCGAGAAATAACAGGGAAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-283s21c1
Sequence:CCGGGACACAAGTGGTGCTCGTTAACTCGAGTTAACGAGCACCACTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-179s21c1
Sequence:CCGGTGTGGAAACTATAACTCATTTCTCGAGAAATGAGTTATAGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-434s21c1
Sequence:CCGGGTGTTCACTGACCAAGAATTTCTCGAGAAATTCTTGGTCAGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128326
BSPH1 MISSION shRNA Lentiviral Transduction Particles
binder of sperm protein homolog 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-224s21c1
Sequence:CCGGTGTCTTTCCATTCCACTATAACTCGAGTTATAGTGGAATGGAAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-139s21c1
Sequence:CCGGCTTGCATCTTCCCTGTTATTTCTCGAGAAATAACAGGGAAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-283s21c1
Sequence:CCGGGACACAAGTGGTGCTCGTTAACTCGAGTTAACGAGCACCACTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-179s21c1
Sequence:CCGGTGTGGAAACTATAACTCATTTCTCGAGAAATGAGTTATAGTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128326.2-434s21c1
Sequence:CCGGGTGTTCACTGACCAAGAATTTCTCGAGAAATTCTTGGTCAGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033418
BSPH1 MISSION shRNA Bacterial Glycerol Stock
binder of sperm protein homolog 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033418.3-505s21c1
Sequence:CCGGTGATGACAACAACGACAATAACTCGAGTTATTGTCGTTGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-238s21c1
Sequence:CCGGATTCTATGACTGTGTCAATTTCTCGAGAAATTGACACAGTCATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-445s21c1
Sequence:CCGGAGACCAAGTTTGGAAATATTGCTCGAGCAATATTTCCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-467s21c1
Sequence:CCGGATAGAGTGATGAGATTTATTGCTCGAGCAATAAATCTCATCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-157s21c1
Sequence:CCGGACCAACTATAGAGTCTTTAATCTCGAGATTAAAGACTCTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033418
BSPH1 MISSION shRNA shRNA Plasmid DNA
binder of sperm protein homolog 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033418.3-505s21c1
Sequence:CCGGTGATGACAACAACGACAATAACTCGAGTTATTGTCGTTGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-238s21c1
Sequence:CCGGATTCTATGACTGTGTCAATTTCTCGAGAAATTGACACAGTCATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-445s21c1
Sequence:CCGGAGACCAAGTTTGGAAATATTGCTCGAGCAATATTTCCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-467s21c1
Sequence:CCGGATAGAGTGATGAGATTTATTGCTCGAGCAATAAATCTCATCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-157s21c1
Sequence:CCGGACCAACTATAGAGTCTTTAATCTCGAGATTAAAGACTCTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033418
BSPH1 MISSION shRNA Lentiviral Transduction Particles
binder of sperm protein homolog 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033418.3-505s21c1
Sequence:CCGGTGATGACAACAACGACAATAACTCGAGTTATTGTCGTTGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-238s21c1
Sequence:CCGGATTCTATGACTGTGTCAATTTCTCGAGAAATTGACACAGTCATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-445s21c1
Sequence:CCGGAGACCAAGTTTGGAAATATTGCTCGAGCAATATTTCCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-467s21c1
Sequence:CCGGATAGAGTGATGAGATTTATTGCTCGAGCAATAAATCTCATCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033418.3-157s21c1
Sequence:CCGGACCAACTATAGAGTCTTTAATCTCGAGATTAAAGACTCTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks