EMAIL THIS PAGE TO A FRIEND

BSPRY

B-box and SPRY domain containing

59 Gene Product Result for
UniProtKB ID: Q5W0U4, B3KS19, Q96DJ2, Q9H4E4, Q9NXN0
Gene ID:
Mouse(192120) B-box and SPRY domain containing
Rat(64027) B-box and SPRY domain containing
Zebrafish(559377) B-box and SPRY domain containing
cow(510681) B-box and SPRY domain containing
chicken(417272) B-box and SPRY domain containing
domestic cat(101082102) B-box and SPRY domain containing
dog(481682) B-box and SPRY domain containing
naked mole-rat(101702754) B-box and SPRY domain containing
domestic guinea pig(100722789) B-box and SPRY domain containing
sheep(101119885) B-box and SPRY domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017688 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133021 MISSION® esiRNA esiRNA human BSPRY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017688 Rosetta Predictions human pricing
NM_022261 Rosetta Predictions rat pricing
NM_138653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039331 predicted 923
2 SASI_Hs01_00039332 predicted 900
3 SASI_Hs02_00350439 predicted 429
4 SASI_Hs01_00039333 predicted 776
5 SASI_Hs01_00039334 predicted 896
6 SASI_Hs01_00039336 predicted 818
7 SASI_Hs01_00039337 predicted 770
8 SASI_Hs02_00350440 predicted 365
9 SASI_Hs01_00039338 predicted 471
10 SASI_Hs01_00039339 predicted 841
11 SASI_Hs01_00039335 predicted 935
12 SASI_Hs01_00039340 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263056 predicted 1164
2 SASI_Rn02_00263057 predicted 1609
3 SASI_Rn02_00263058 predicted 1180
4 SASI_Rn01_00061579 predicted 978
5 SASI_Rn01_00061578 predicted 916
6 SASI_Rn02_00263059 predicted 681
7 SASI_Rn02_00263060 predicted 1616
8 SASI_Rn02_00263061 predicted 472
9 SASI_Rn02_00263062 predicted 826
10 SASI_Rn02_00263063 predicted 1340
11 SASI_Rn01_00061573 predicted 304
12 SASI_Rn01_00061574 predicted 518
13 SASI_Rn01_00061575 predicted 326
14 SASI_Rn01_00061576 predicted 677
15 SASI_Rn01_00061577 predicted 536
16 SASI_Rn01_00061580 predicted 682
17 SASI_Rn01_00061581 predicted 452
18 SASI_Rn01_00061582 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101986 predicted 1169
2 SASI_Mm01_00101987 predicted 1246
3 SASI_Mm01_00101988 predicted 651
4 SASI_Mm01_00101989 predicted 972
5 SASI_Mm01_00101990 predicted 1311
6 SASI_Mm01_00101991 predicted 1041
7 SASI_Mm01_00101992 predicted 363
8 SASI_Mm01_00101993 predicted 1180
9 SASI_Mm01_00101994 predicted 1344
10 SASI_Mm01_00101995 predicted 1428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138653
BSPRY MISSION shRNA Bacterial Glycerol Stock
B-box and SPRY domain containing
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1437s21c1
Sequence:CCGGACAACCTGCCAGGATACTGTTCTCGAGAACAGTATCCTGGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1283s21c1
Sequence:CCGGCTCAGGGACGGTGCTTCATATCTCGAGATATGAAGCACCGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138653.1-1497s1c1
Sequence:CCGGGCCTCCTCTGTCTCCAGGAAACTCGAGTTTCCTGGAGACAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1043s1c1
Sequence:CCGGCGTTAAACACAGTTGTGCTTACTCGAGTAAGCACAACTGTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-413s1c1
Sequence:CCGGTGCTGGCATCTCCAAGTATATCTCGAGATATACTTGGAGATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1156s1c1
Sequence:CCGGGCTATGATCAAGAGTTCTGTTCTCGAGAACAGAACTCTTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1029s1c1
Sequence:CCGGGCCTGGATAGTGAACGTTAAACTCGAGTTTAACGTTCACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138653
BSPRY MISSION shRNA shRNA Plasmid DNA
B-box and SPRY domain containing
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1437s21c1
Sequence:CCGGACAACCTGCCAGGATACTGTTCTCGAGAACAGTATCCTGGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1283s21c1
Sequence:CCGGCTCAGGGACGGTGCTTCATATCTCGAGATATGAAGCACCGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138653.1-1497s1c1
Sequence:CCGGGCCTCCTCTGTCTCCAGGAAACTCGAGTTTCCTGGAGACAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1043s1c1
Sequence:CCGGCGTTAAACACAGTTGTGCTTACTCGAGTAAGCACAACTGTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-413s1c1
Sequence:CCGGTGCTGGCATCTCCAAGTATATCTCGAGATATACTTGGAGATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1156s1c1
Sequence:CCGGGCTATGATCAAGAGTTCTGTTCTCGAGAACAGAACTCTTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1029s1c1
Sequence:CCGGGCCTGGATAGTGAACGTTAAACTCGAGTTTAACGTTCACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138653
BSPRY MISSION shRNA Lentiviral Transduction Particles
B-box and SPRY domain containing
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1437s21c1
Sequence:CCGGACAACCTGCCAGGATACTGTTCTCGAGAACAGTATCCTGGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138653.1-1283s21c1
Sequence:CCGGCTCAGGGACGGTGCTTCATATCTCGAGATATGAAGCACCGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138653.1-1497s1c1
Sequence:CCGGGCCTCCTCTGTCTCCAGGAAACTCGAGTTTCCTGGAGACAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1043s1c1
Sequence:CCGGCGTTAAACACAGTTGTGCTTACTCGAGTAAGCACAACTGTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-413s1c1
Sequence:CCGGTGCTGGCATCTCCAAGTATATCTCGAGATATACTTGGAGATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1156s1c1
Sequence:CCGGGCTATGATCAAGAGTTCTGTTCTCGAGAACAGAACTCTTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138653.1-1029s1c1
Sequence:CCGGGCCTGGATAGTGAACGTTAAACTCGAGTTTAACGTTCACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017688
VALIDATED
BSPRY MISSION shRNA Bacterial Glycerol Stock
B-box and SPRY domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1404s21c1
Sequence:CCGGCTGTTTCAGATCTAGGCATAACTCGAGTTATGCCTAGATCTGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-769s21c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1034s21c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1045s21c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-641s21c1
Sequence:CCGGAGTCGGAAATGTTAAACTTTACTCGAGTAAAGTTTAACATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017688.1-1056s1c1
Sequence:CCGGCCAAATGATGTGTGTGGTGTTCTCGAGAACACCACACACATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-760s1c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-771s1c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-495s1c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017688.1-299s1c1
Sequence:CCGGGCTGATTCAGAAGGAGCAAGACTCGAGTCTTGCTCCTTCTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-648s1c1
Sequence:CCGGGTCCAGAACAGTTGTGCCTATCTCGAGATAGGCACAACTGTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017688
VALIDATED
BSPRY MISSION shRNA shRNA Plasmid DNA
B-box and SPRY domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1404s21c1
Sequence:CCGGCTGTTTCAGATCTAGGCATAACTCGAGTTATGCCTAGATCTGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-769s21c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1034s21c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1045s21c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-641s21c1
Sequence:CCGGAGTCGGAAATGTTAAACTTTACTCGAGTAAAGTTTAACATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017688.1-1056s1c1
Sequence:CCGGCCAAATGATGTGTGTGGTGTTCTCGAGAACACCACACACATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-760s1c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-771s1c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-495s1c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017688.1-299s1c1
Sequence:CCGGGCTGATTCAGAAGGAGCAAGACTCGAGTCTTGCTCCTTCTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-648s1c1
Sequence:CCGGGTCCAGAACAGTTGTGCCTATCTCGAGATAGGCACAACTGTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017688
VALIDATED
BSPRY MISSION shRNA Lentiviral Transduction Particles
B-box and SPRY domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1404s21c1
Sequence:CCGGCTGTTTCAGATCTAGGCATAACTCGAGTTATGCCTAGATCTGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-769s21c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1034s21c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-1045s21c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017688.2-641s21c1
Sequence:CCGGAGTCGGAAATGTTAAACTTTACTCGAGTAAAGTTTAACATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017688.1-1056s1c1
Sequence:CCGGCCAAATGATGTGTGTGGTGTTCTCGAGAACACCACACACATCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-760s1c1
Sequence:CCGGGCTATGATCAGGAGTTTCGTTCTCGAGAACGAAACTCCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-771s1c1
Sequence:CCGGGAGTTTCGTTTCTCACACAATCTCGAGATTGTGTGAGAAACGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-495s1c1
Sequence:CCGGCCCTTCCTGCAATTGTCAGATCTCGAGATCTGACAATTGCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017688.1-299s1c1
Sequence:CCGGGCTGATTCAGAAGGAGCAAGACTCGAGTCTTGCTCCTTCTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017688.1-648s1c1
Sequence:CCGGGTCCAGAACAGTTGTGCCTATCTCGAGATAGGCACAACTGTTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks