EMAIL THIS PAGE TO A FRIEND

BST1

bone marrow stromal cell antigen 1

81 Gene Product Result for
Synonyms: CD157
UniProtKB ID: Q10588, B2R6A2, Q5U0K0, Q96EN3
Gene ID:
Human(683) Summary: Bone marrow stromal cell antigen-1 is a stromal cell line-derived glycosylphosphatidylinositol-anchored molecule that facilitates pre-B-cell growth. The deduced amino acid sequence exhibits 33% similarity with CD38. BST1 expression is enhanced in bone marrow stromal cell lines derived from patients with rheumatoid arthritis. The polyclonal B-cell abnormalities in rheumatoid arthritis may be, at least in part, attributed to BST1 overexpression in the stromal cell population. [provided by RefSeq, Jul 2008]
Mouse(12182) bone marrow stromal cell antigen 1
Rat(81506) bone marrow stromal cell antigen 1
sheep(101116575) bone marrow stromal cell antigen 1
domestic guinea pig(100726264) bone marrow stromal cell antigen 1
naked mole-rat(101713685) bone marrow stromal cell antigen 1
Thale Cress(836633) deformned root hairs 4
chicken(422828) bone marrow stromal cell antigen 1
dog(488820) bone marrow stromal cell antigen 1
domestic cat(101101052) bone marrow stromal cell antigen 1
cow(616757) bone marrow stromal cell antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149081 MISSION® esiRNA esiRNA human BST1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004334 Rosetta Predictions human pricing
NM_030848 Rosetta Predictions rat pricing
XM_579495 Rosetta Predictions rat pricing
NM_009763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035936 predicted 955
2 SASI_Hs01_00035937 predicted 1021
3 SASI_Hs01_00035938 predicted 967
4 SASI_Hs02_00337387 predicted 715
5 SASI_Hs01_00035939 predicted 854
6 SASI_Hs01_00035941 predicted 589
7 SASI_Hs01_00035940 predicted 1136
8 SASI_Hs01_00035942 predicted 654
9 SASI_Hs01_00035943 predicted 546
10 SASI_Hs01_00035944 predicted 1202
11 SASI_Hs01_00035945 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093639 predicted 283
2 SASI_Rn01_00093640 predicted 313
3 SASI_Rn01_00093641 predicted 555
4 SASI_Rn01_00093642 predicted 1044
5 SASI_Rn01_00093643 predicted 921
6 SASI_Rn01_00093644 predicted 330
7 SASI_Rn01_00093645 predicted 675
8 SASI_Rn02_00264083 predicted 957
9 SASI_Rn01_00093646 predicted 643
10 SASI_Rn01_00093647 predicted 1144
11 SASI_Rn01_00093648 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149687 predicted 529
2 SASI_Rn01_00149688 predicted 315
3 SASI_Rn01_00149689 predicted 503
4 SASI_Rn01_00149690 predicted 490
5 SASI_Rn01_00149691 predicted 535
6 SASI_Rn01_00149692 predicted 359
7 SASI_Rn01_00149693 predicted 471
8 SASI_Rn01_00149694 predicted 427
9 SASI_Rn01_00149695 predicted 393
10 SASI_Rn01_00149696 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089932 predicted 633
2 SASI_Mm01_00089933 predicted 269
3 SASI_Mm01_00089934 predicted 309
4 SASI_Mm01_00089935 predicted 927
5 SASI_Mm01_00089936 predicted 1168
6 SASI_Mm01_00089937 predicted 1193
7 SASI_Mm02_00316958 predicted 1093
8 SASI_Mm02_00316959 predicted 932
9 SASI_Mm01_00089938 predicted 1108
10 SASI_Mm01_00089939 predicted 1232
11 SASI_Mm01_00089931 predicted 1083
12 SASI_Mm01_00089940 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004334
BST1 MISSION shRNA Bacterial Glycerol Stock
bone marrow stromal cell antigen 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-599s1c1
Sequence:CCGGCCTACATCAGAAGACTGTGAACTCGAGTTCACAGTCTTCTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-955s1c1
Sequence:CCGGCCATCCTGACTGTGCCTTAAACTCGAGTTTAAGGCACAGTCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-654s1c1
Sequence:CCGGCCATCCAGTATTCCAAGGATACTCGAGTATCCTTGGAATACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-1007s1c1
Sequence:CCGGCCAAGTCTTTATACAGAACAACTCGAGTTGTTCTGTATAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-849s1c1
Sequence:CCGGGCAGCATGAAAGTCCTGGAAACTCGAGTTTCCAGGACTTTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004334.2-1323s21c1
Sequence:CCGGCAAGAAGTTAGTTCTATTTAGCTCGAGCTAAATAGAACTAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-983s21c1
Sequence:CCGGACCGACCAGTGAAGCTCTTACCTCGAGGTAAGAGCTTCACTGGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-855s21c1
Sequence:CCGGACGAATCGAGATCTGGGTTATCTCGAGATAACCCAGATCTCGATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004334
BST1 MISSION shRNA shRNA Plasmid DNA
bone marrow stromal cell antigen 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-599s1c1
Sequence:CCGGCCTACATCAGAAGACTGTGAACTCGAGTTCACAGTCTTCTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-955s1c1
Sequence:CCGGCCATCCTGACTGTGCCTTAAACTCGAGTTTAAGGCACAGTCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-654s1c1
Sequence:CCGGCCATCCAGTATTCCAAGGATACTCGAGTATCCTTGGAATACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-1007s1c1
Sequence:CCGGCCAAGTCTTTATACAGAACAACTCGAGTTGTTCTGTATAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-849s1c1
Sequence:CCGGGCAGCATGAAAGTCCTGGAAACTCGAGTTTCCAGGACTTTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004334.2-1323s21c1
Sequence:CCGGCAAGAAGTTAGTTCTATTTAGCTCGAGCTAAATAGAACTAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-983s21c1
Sequence:CCGGACCGACCAGTGAAGCTCTTACCTCGAGGTAAGAGCTTCACTGGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-855s21c1
Sequence:CCGGACGAATCGAGATCTGGGTTATCTCGAGATAACCCAGATCTCGATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004334
BST1 MISSION shRNA Lentiviral Transduction Particles
bone marrow stromal cell antigen 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-599s1c1
Sequence:CCGGCCTACATCAGAAGACTGTGAACTCGAGTTCACAGTCTTCTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-955s1c1
Sequence:CCGGCCATCCTGACTGTGCCTTAAACTCGAGTTTAAGGCACAGTCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-654s1c1
Sequence:CCGGCCATCCAGTATTCCAAGGATACTCGAGTATCCTTGGAATACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-1007s1c1
Sequence:CCGGCCAAGTCTTTATACAGAACAACTCGAGTTGTTCTGTATAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004334.1-849s1c1
Sequence:CCGGGCAGCATGAAAGTCCTGGAAACTCGAGTTTCCAGGACTTTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004334.2-1323s21c1
Sequence:CCGGCAAGAAGTTAGTTCTATTTAGCTCGAGCTAAATAGAACTAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-983s21c1
Sequence:CCGGACCGACCAGTGAAGCTCTTACCTCGAGGTAAGAGCTTCACTGGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004334.2-855s21c1
Sequence:CCGGACGAATCGAGATCTGGGTTATCTCGAGATAACCCAGATCTCGATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009763
VALIDATED
BST1 MISSION shRNA Bacterial Glycerol Stock
bone marrow stromal cell antigen 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-1126s1c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-785s1c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009763.1-916s1c1
Sequence:CCGGCTCTCTTAGTAGCTTTGGCTTCTCGAGAAGCCAAAGCTACTAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-764s1c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-258s1c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-275s21c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-781s21c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-802s21c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009763.3-1143s21c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009763
VALIDATED
BST1 MISSION shRNA shRNA Plasmid DNA
bone marrow stromal cell antigen 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-1126s1c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-785s1c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009763.1-916s1c1
Sequence:CCGGCTCTCTTAGTAGCTTTGGCTTCTCGAGAAGCCAAAGCTACTAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-764s1c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-258s1c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-275s21c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-781s21c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-802s21c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009763.3-1143s21c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009763
VALIDATED
BST1 MISSION shRNA Lentiviral Transduction Particles
bone marrow stromal cell antigen 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-1126s1c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-785s1c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009763.1-916s1c1
Sequence:CCGGCTCTCTTAGTAGCTTTGGCTTCTCGAGAAGCCAAAGCTACTAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-764s1c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009763.1-258s1c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-275s21c1
Sequence:CCGGTCAGACTATGATCTCTTCATTCTCGAGAATGAAGAGATCATAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-781s21c1
Sequence:CCGGGCACAGCTGTATCAATGACTACTCGAGTAGTCATTGATACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009763.3-802s21c1
Sequence:CCGGCCGACCAGTGAAGTTCTTAATCTCGAGATTAAGAACTTCACTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009763.3-1143s21c1
Sequence:CCGGGCATTCATCTAGTCCTGCTTACTCGAGTAAGCAGGACTAGATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks