EMAIL THIS PAGE TO A FRIEND

BST2

bone marrow stromal cell antigen 2

62 Gene Product Result for
Synonyms: CD317 TETHERIN
UniProtKB ID: Q10589, A8K4Y4, Q53G07
Gene ID:
Human(684) Summary: Bone marrow stromal cells are involved in the growth and development of B-cells. The specific function of the protein encoded by the bone marrow stromal cell antigen 2 is undetermined; however, this protein may play a role in pre-B-cell growth and in rheumatoid arthritis. [provided by RefSeq, Jul 2008]
Mouse(69550) bone marrow stromal cell antigen 2
Rat(378947) bone marrow stromal cell antigen 2
dog(609654) bone marrow stromal cell antigen 2
domestic cat(100652388) bone marrow stromal cell antigen 2
cow(618737) bone marrow stromal cell antigen 2
naked mole-rat(101715375) bone marrow stromal cell antigen 2
domestic guinea pig(100732731) bone marrow stromal cell antigen 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B2563 Anti-BST2 (146-159) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501632 Anti-BST2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1400028 Anti-BST2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4661 Anti-BST2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
HPA017060 Anti-BST2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1400029 Anti-BST2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB4500221 Anti-BST2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1403618 Monoclonal Anti-BST2 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation, western blot pricing
SAB1402131 Monoclonal Anti-BST2, (C-terminal) antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004335 Rosetta Predictions human pricing
NM_198134 Rosetta Predictions rat pricing
NM_198095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191496 predicted 606
2 SASI_Hs02_00337388 predicted 439
3 SASI_Hs01_00191498 predicted 357
4 SASI_Hs01_00191499 predicted 278
5 SASI_Hs01_00191500 predicted 354
6 SASI_Hs01_00191501 predicted 601
7 SASI_Hs01_00191503 predicted 288
8 SASI_Hs02_00337389 predicted 378
9 SASI_Hs01_00191505 predicted 608
10 SASI_Hs02_00337390 predicted 556
11 SASI_Hs01_00191497 predicted 234
12 SASI_Hs01_00191502 predicted 235
13 SASI_Hs01_00191504 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269919 predicted 308
2 SASI_Rn01_00059166 predicted 368
3 SASI_Rn01_00059167 predicted 372
4 SASI_Rn01_00059168 predicted 300
5 SASI_Rn01_00059169 predicted 367
6 SASI_Rn02_00269920 predicted 296
7 SASI_Rn02_00269921 predicted 336
8 SASI_Rn01_00059170 predicted 440
9 SASI_Rn01_00059171 predicted 304
10 SASI_Rn01_00059173 predicted 438
11 SASI_Rn01_00059172 predicted 283
12 SASI_Rn01_00059174 predicted 209
13 SASI_Rn01_00059175 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051340 predicted 361
2 SASI_Mm01_00051341 predicted 371
3 SASI_Mm01_00051342 predicted 479
4 SASI_Mm02_00350819 predicted 408
5 SASI_Mm01_00051343 predicted 362
6 SASI_Mm01_00051344 predicted 484
7 SASI_Mm01_00051345 predicted 489
8 SASI_Mm01_00051346 predicted 286
9 SASI_Mm01_00051348 predicted 435
10 SASI_Mm02_00350820 predicted 224
11 SASI_Mm01_00051339 predicted 401
12 SASI_Mm01_00051347 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004335
VALIDATED
BST2 MISSION shRNA Bacterial Glycerol Stock
bone marrow stromal cell antigen 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-556s21c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-98s21c1
Sequence:CCGGTGCTCCTGATCATCGTGATTCCTCGAGGAATCACGATGATCAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-432s21c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-359s21c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-285s21c1
Sequence:CCGGCCACACTGTGATGGCCCTAATCTCGAGATTAGGGCCATCACAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004335.2-556s1c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-359s1c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-358s1c1
Sequence:CCGGGAGGGAGAGATCACTACATTACTCGAGTAATGTAGTGATCTCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-126s1c1
Sequence:CCGGGCCCTTGATTATCTTCACCATCTCGAGATGGTGAAGATAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-432s1c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004335
VALIDATED
BST2 MISSION shRNA shRNA Plasmid DNA
bone marrow stromal cell antigen 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-556s21c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-98s21c1
Sequence:CCGGTGCTCCTGATCATCGTGATTCCTCGAGGAATCACGATGATCAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-432s21c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-359s21c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-285s21c1
Sequence:CCGGCCACACTGTGATGGCCCTAATCTCGAGATTAGGGCCATCACAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004335.2-556s1c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-359s1c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-358s1c1
Sequence:CCGGGAGGGAGAGATCACTACATTACTCGAGTAATGTAGTGATCTCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-126s1c1
Sequence:CCGGGCCCTTGATTATCTTCACCATCTCGAGATGGTGAAGATAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-432s1c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004335
VALIDATED
BST2 MISSION shRNA Lentiviral Transduction Particles
bone marrow stromal cell antigen 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-556s21c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-98s21c1
Sequence:CCGGTGCTCCTGATCATCGTGATTCCTCGAGGAATCACGATGATCAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-432s21c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-359s21c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004335.2-285s21c1
Sequence:CCGGCCACACTGTGATGGCCCTAATCTCGAGATTAGGGCCATCACAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004335.2-556s1c1
Sequence:CCGGCCCAGGAAGCTGGCACATCTTCTCGAGAAGATGTGCCAGCTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-359s1c1
Sequence:CCGGAGGGAGAGATCACTACATTAACTCGAGTTAATGTAGTGATCTCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-358s1c1
Sequence:CCGGGAGGGAGAGATCACTACATTACTCGAGTAATGTAGTGATCTCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-126s1c1
Sequence:CCGGGCCCTTGATTATCTTCACCATCTCGAGATGGTGAAGATAATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004335.2-432s1c1
Sequence:CCGGCCAGGTCTTAAGCGTGAGAATCTCGAGATTCTCACGCTTAAGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198095
VALIDATED
BST2 MISSION shRNA Bacterial Glycerol Stock
bone marrow stromal cell antigen 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-584s1c1
Sequence:CCGGCACAGTTGTTTGAAGTCACTACTCGAGTAGTGACTTCAAACAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-413s1c1
Sequence:CCGGGCTTGAGAATGAAGTCACGAACTCGAGTTCGTGACTTCATTCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-363s1c1
Sequence:CCGGCTGGAGAAGAAGGTGTCTCAACTCGAGTTGAGACACCTTCTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-209s1c1
Sequence:CCGGCGTGGCCTGTAGAGACGGGTTCTCGAGAACCCGTCTCTACAGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-137s1c1
Sequence:CCGGCGCGATCTTGGTGGTCCTGTTCTCGAGAACAGGACCACCAAGATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198095
VALIDATED
BST2 MISSION shRNA shRNA Plasmid DNA
bone marrow stromal cell antigen 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-584s1c1
Sequence:CCGGCACAGTTGTTTGAAGTCACTACTCGAGTAGTGACTTCAAACAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-413s1c1
Sequence:CCGGGCTTGAGAATGAAGTCACGAACTCGAGTTCGTGACTTCATTCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-363s1c1
Sequence:CCGGCTGGAGAAGAAGGTGTCTCAACTCGAGTTGAGACACCTTCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-209s1c1
Sequence:CCGGCGTGGCCTGTAGAGACGGGTTCTCGAGAACCCGTCTCTACAGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-137s1c1
Sequence:CCGGCGCGATCTTGGTGGTCCTGTTCTCGAGAACAGGACCACCAAGATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198095
VALIDATED
BST2 MISSION shRNA Lentiviral Transduction Particles
bone marrow stromal cell antigen 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-584s1c1
Sequence:CCGGCACAGTTGTTTGAAGTCACTACTCGAGTAGTGACTTCAAACAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-413s1c1
Sequence:CCGGGCTTGAGAATGAAGTCACGAACTCGAGTTCGTGACTTCATTCTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-363s1c1
Sequence:CCGGCTGGAGAAGAAGGTGTCTCAACTCGAGTTGAGACACCTTCTTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198095.1-209s1c1
Sequence:CCGGCGTGGCCTGTAGAGACGGGTTCTCGAGAACCCGTCTCTACAGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198095.1-137s1c1
Sequence:CCGGCGCGATCTTGGTGGTCCTGTTCTCGAGAACAGGACCACCAAGATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)