EMAIL THIS PAGE TO A FRIEND

BSX

brain-specific homeobox

61 Gene Product Result for
Synonyms: BSX1
UniProtKB ID: Q3C1V8
Gene ID:
Mouse(244813) brain specific homeobox
Rat(500982) brain specific homeobox
naked mole-rat(101708660) brain-specific homeobox
domestic guinea pig(100721164) brain-specific homeobox
sheep(101118218) brain-specific homeobox
Zebrafish(573364) brain specific homeobox
chicken(395183) brain-specific homeobox
cow(615347) brain-specific homeobox
Horse(100071656) brain-specific homeobox
domestic cat(101091808) brain-specific homeobox
dog(489354) brain-specific homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015654 Anti-BSX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098169 Rosetta Predictions human pricing
XM_372433 Rosetta Predictions human pricing
XM_001064837 Rosetta Predictions rat pricing
XM_576393 Rosetta Predictions rat pricing
NM_178245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318578 predicted 326
2 SASI_Hs02_00318579 predicted 195
3 SASI_Hs02_00318580 predicted 376
4 SASI_Hs02_00318581 predicted 203
5 SASI_Hs02_00318582 predicted 326
6 SASI_Hs02_00318583 predicted 387
7 SASI_Hs02_00318584 predicted 198
8 SASI_Hs02_00318585 predicted 387
9 SASI_Hs02_00318586 predicted 326
10 SASI_Hs02_00318587 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259170 predicted 466
2 SASI_Hs01_00259171 predicted 576
3 SASI_Hs01_00259172 predicted 239
4 SASI_Hs01_00259173 predicted 687
5 SASI_Hs01_00259174 predicted 652
6 SASI_Hs01_00259175 predicted 855
7 SASI_Hs01_00259176 predicted 830
8 SASI_Hs01_00259177 predicted 667
9 SASI_Hs01_00259178 predicted 850
10 SASI_Hs01_00259179 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311923 predicted 479
2 SASI_Rn02_00311924 predicted 626
3 SASI_Rn02_00311925 predicted 630
4 SASI_Rn02_00311926 predicted 369
5 SASI_Rn02_00311927 predicted 327
6 SASI_Rn02_00311928 predicted 272
7 SASI_Rn02_00311929 predicted 340
8 SASI_Rn02_00311930 predicted 420
9 SASI_Rn02_00311931 predicted 641
10 SASI_Rn02_00311932 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405221 predicted 476
2 SASI_Rn02_00405222 predicted 626
3 SASI_Rn02_00405223 predicted 630
4 SASI_Rn02_00405224 predicted 367
5 SASI_Rn02_00405225 predicted 326
6 SASI_Rn02_00405226 predicted 274
7 SASI_Rn02_00405227 predicted 343
8 SASI_Rn02_00405228 predicted 421
9 SASI_Rn02_00405229 predicted 645
10 SASI_Rn02_00405230 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077466 predicted 373
2 SASI_Mm01_00077468 predicted 429
3 SASI_Mm01_00077470 predicted 345
4 SASI_Mm01_00077471 predicted 361
5 SASI_Mm02_00348648 predicted 639
6 SASI_Mm01_00077473 predicted 444
7 SASI_Mm01_00077474 predicted 630
8 SASI_Mm01_00077475 predicted 645
9 SASI_Mm02_00348649 predicted 482
10 SASI_Mm02_00348650 predicted 342
11 SASI_Mm01_00077467 predicted 496
12 SASI_Mm01_00077469 predicted 587
13 SASI_Mm01_00077472 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372433
BSX MISSION shRNA Bacterial Glycerol Stock
brain-specific homeobox
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-445s1c1
Sequence:CCGGCATAAGGGAGACCACCATCATCTCGAGATGATGGTGGTCTCCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-234s1c1
Sequence:CCGGCAACTTCACCTCTCCTCTACACTCGAGTGTAGAGGAGAGGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-219s1c1
Sequence:CCGGGCTCAAGATGAATCTCAACTTCTCGAGAAGTTGAGATTCATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-452s1c1
Sequence:CCGGGAGACCACCATCATCCTTATTCTCGAGAATAAGGATGATGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-278s1c1
Sequence:CCGGCATCCTTCTTCATCGAGGACACTCGAGTGTCCTCGATGAAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-597s1c1
Sequence:CCGGCTTGGAGAAGAGGTTCGAGATCTCGAGATCTCGAACCTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372433
BSX MISSION shRNA shRNA Plasmid DNA
brain-specific homeobox
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-445s1c1
Sequence:CCGGCATAAGGGAGACCACCATCATCTCGAGATGATGGTGGTCTCCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-234s1c1
Sequence:CCGGCAACTTCACCTCTCCTCTACACTCGAGTGTAGAGGAGAGGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-219s1c1
Sequence:CCGGGCTCAAGATGAATCTCAACTTCTCGAGAAGTTGAGATTCATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-452s1c1
Sequence:CCGGGAGACCACCATCATCCTTATTCTCGAGAATAAGGATGATGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-278s1c1
Sequence:CCGGCATCCTTCTTCATCGAGGACACTCGAGTGTCCTCGATGAAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-597s1c1
Sequence:CCGGCTTGGAGAAGAGGTTCGAGATCTCGAGATCTCGAACCTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372433
BSX MISSION shRNA Lentiviral Transduction Particles
brain-specific homeobox
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-445s1c1
Sequence:CCGGCATAAGGGAGACCACCATCATCTCGAGATGATGGTGGTCTCCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-234s1c1
Sequence:CCGGCAACTTCACCTCTCCTCTACACTCGAGTGTAGAGGAGAGGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-219s1c1
Sequence:CCGGGCTCAAGATGAATCTCAACTTCTCGAGAAGTTGAGATTCATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-452s1c1
Sequence:CCGGGAGACCACCATCATCCTTATTCTCGAGAATAAGGATGATGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-278s1c1
Sequence:CCGGCATCCTTCTTCATCGAGGACACTCGAGTGTCCTCGATGAAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372433.1-597s1c1
Sequence:CCGGCTTGGAGAAGAGGTTCGAGATCTCGAGATCTCGAACCTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178245
BSX MISSION shRNA Bacterial Glycerol Stock
brain-specific homeobox
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-193s1c1
Sequence:CCGGAGGGTGCCTTTGCTAGACTATCTCGAGATAGTCTAGCAAAGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-123s1c1
Sequence:CCGGCATTCTGCTACACAAGCCCAACTCGAGTTGGGCTTGTGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-262s1c1
Sequence:CCGGCATCCTCTGCATAAGGGAGATCTCGAGATCTCCCTTATGCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-666s1c1
Sequence:CCGGCGGTGCCTTCGTGCTTACTGACTCGAGTCAGTAAGCACGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-382s1c1
Sequence:CCGGCGCAAAGCTCGCACGGTGTTTCTCGAGAAACACCGTGCGAGCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-435s21c1
Sequence:CCGGGTTCGAAATCCAGCGCTACCTCTCGAGAGGTAGCGCTGGATTTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-289s21c1
Sequence:CCGGCATCCTTATTTCCTGACCACCCTCGAGGGTGGTCAGGAAATAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-91s21c1
Sequence:CCGGTCTCAGAGGCCCACGTCGTTTCTCGAGAAACGACGTGGGCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-165s21c1
Sequence:CCGGTGACCACTTTGCCAGCTCTCTCTCGAGAGAGAGCTGGCAAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178245
BSX MISSION shRNA shRNA Plasmid DNA
brain-specific homeobox
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-193s1c1
Sequence:CCGGAGGGTGCCTTTGCTAGACTATCTCGAGATAGTCTAGCAAAGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-123s1c1
Sequence:CCGGCATTCTGCTACACAAGCCCAACTCGAGTTGGGCTTGTGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-262s1c1
Sequence:CCGGCATCCTCTGCATAAGGGAGATCTCGAGATCTCCCTTATGCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-666s1c1
Sequence:CCGGCGGTGCCTTCGTGCTTACTGACTCGAGTCAGTAAGCACGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-382s1c1
Sequence:CCGGCGCAAAGCTCGCACGGTGTTTCTCGAGAAACACCGTGCGAGCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-435s21c1
Sequence:CCGGGTTCGAAATCCAGCGCTACCTCTCGAGAGGTAGCGCTGGATTTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-289s21c1
Sequence:CCGGCATCCTTATTTCCTGACCACCCTCGAGGGTGGTCAGGAAATAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-91s21c1
Sequence:CCGGTCTCAGAGGCCCACGTCGTTTCTCGAGAAACGACGTGGGCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-165s21c1
Sequence:CCGGTGACCACTTTGCCAGCTCTCTCTCGAGAGAGAGCTGGCAAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178245
BSX MISSION shRNA Lentiviral Transduction Particles
brain-specific homeobox
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-193s1c1
Sequence:CCGGAGGGTGCCTTTGCTAGACTATCTCGAGATAGTCTAGCAAAGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-123s1c1
Sequence:CCGGCATTCTGCTACACAAGCCCAACTCGAGTTGGGCTTGTGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-262s1c1
Sequence:CCGGCATCCTCTGCATAAGGGAGATCTCGAGATCTCCCTTATGCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-666s1c1
Sequence:CCGGCGGTGCCTTCGTGCTTACTGACTCGAGTCAGTAAGCACGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178245.2-382s1c1
Sequence:CCGGCGCAAAGCTCGCACGGTGTTTCTCGAGAAACACCGTGCGAGCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-435s21c1
Sequence:CCGGGTTCGAAATCCAGCGCTACCTCTCGAGAGGTAGCGCTGGATTTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-289s21c1
Sequence:CCGGCATCCTTATTTCCTGACCACCCTCGAGGGTGGTCAGGAAATAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-91s21c1
Sequence:CCGGTCTCAGAGGCCCACGTCGTTTCTCGAGAAACGACGTGGGCCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178245.3-165s21c1
Sequence:CCGGTGACCACTTTGCCAGCTCTCTCTCGAGAGAGAGCTGGCAAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098169
BSX MISSION shRNA Bacterial Glycerol Stock
brain-specific homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-44s21c1
Sequence:CCGGAGAGGCCCACATCCTTCTTCACTCGAGTGAAGAAGGATGTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-143s21c1
Sequence:CCGGGGGTGCCTCTGCTAGACTATGCTCGAGCATAGTCTAGCAGAGGCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-205s21c1
Sequence:CCGGGCCCATCACCCTCTGCATAAGCTCGAGCTTATGCAGAGGGTGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-228s21c1
Sequence:CCGGAGACCACCATCATCCTTATTTCTCGAGAAATAAGGATGATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-373s21c1
Sequence:CCGGTTGGAGAAGAGGTTCGAGATCCTCGAGGATCTCGAACCTCTTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098169
BSX MISSION shRNA shRNA Plasmid DNA
brain-specific homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-44s21c1
Sequence:CCGGAGAGGCCCACATCCTTCTTCACTCGAGTGAAGAAGGATGTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-143s21c1
Sequence:CCGGGGGTGCCTCTGCTAGACTATGCTCGAGCATAGTCTAGCAGAGGCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-205s21c1
Sequence:CCGGGCCCATCACCCTCTGCATAAGCTCGAGCTTATGCAGAGGGTGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-228s21c1
Sequence:CCGGAGACCACCATCATCCTTATTTCTCGAGAAATAAGGATGATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-373s21c1
Sequence:CCGGTTGGAGAAGAGGTTCGAGATCCTCGAGGATCTCGAACCTCTTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098169
BSX MISSION shRNA Lentiviral Transduction Particles
brain-specific homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-44s21c1
Sequence:CCGGAGAGGCCCACATCCTTCTTCACTCGAGTGAAGAAGGATGTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-143s21c1
Sequence:CCGGGGGTGCCTCTGCTAGACTATGCTCGAGCATAGTCTAGCAGAGGCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-205s21c1
Sequence:CCGGGCCCATCACCCTCTGCATAAGCTCGAGCTTATGCAGAGGGTGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-228s21c1
Sequence:CCGGAGACCACCATCATCCTTATTTCTCGAGAAATAAGGATGATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098169.1-373s21c1
Sequence:CCGGTTGGAGAAGAGGTTCGAGATCCTCGAGGATCTCGAACCTCTTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks