EMAIL THIS PAGE TO A FRIEND

BTAF1

BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa

223 Gene Product Result for
Synonyms: MOT1 TAF(II)170 TAF172 TAFII170
UniProtKB ID: O14981, O43578
Gene ID:
Human(9044) Summary: This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
Mouse(107182) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, (Mot1 homolog, S. cerevisiae)
Rat(368042) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, (Mot1 homolog, S. cerevisiae)
Zebrafish(565357) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated
domestic cat(101084740) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)
cow(523664) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
dog(486800) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)
chicken(423817) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)
naked mole-rat(101725093) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
domestic guinea pig(100723222) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
sheep(101101938) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)
Domestic Rabbit(100345873) BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0047 AQUA Peptide AAFAITS[R] chicken, cow, dog, human, mouse, rat pricing
AQ0116 AQUA Peptide IAAGQAVEAIV[K] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003972 Rosetta Predictions human pricing
XM_001080159 Rosetta Predictions rat pricing
XM_347206 Rosetta Predictions rat pricing
NM_001080706 Rosetta Predictions mouse pricing
XM_001001026 Rosetta Predictions mouse pricing
XM_129248 Rosetta Predictions mouse pricing
XM_901021 Rosetta Predictions mouse pricing
XM_901025 Rosetta Predictions mouse pricing
XM_901029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336661 predicted 1948
2 SASI_Hs02_00336662 predicted 4149
3 SASI_Hs01_00056675 predicted 342
4 SASI_Hs02_00336663 predicted 4806
5 SASI_Hs01_00056677 predicted 4179
6 SASI_Hs01_00056679 predicted 1537
7 SASI_Hs01_00056680 predicted 5323
8 SASI_Hs01_00056682 predicted 428
9 SASI_Hs02_00336664 predicted 2645
10 SASI_Hs01_00056684 predicted 576
11 SASI_Hs01_00056676 predicted 1244
12 SASI_Hs01_00056678 predicted 4652
13 SASI_Hs01_00056681 predicted 1716
14 SASI_Hs01_00056683 predicted 2779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366854 predicted 591
2 SASI_Rn02_00366855 predicted 5801
3 SASI_Rn02_00366856 predicted 1660
4 SASI_Rn02_00366857 predicted 1037
5 SASI_Rn02_00366858 predicted 1743
6 SASI_Rn02_00366859 predicted 5008
7 SASI_Rn02_00366860 predicted 5621
8 SASI_Rn02_00366861 predicted 1888
9 SASI_Rn02_00366862 predicted 3326
10 SASI_Rn02_00366863 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399586 predicted 586
2 SASI_Rn02_00399587 predicted 5805
3 SASI_Rn02_00399588 predicted 1659
4 SASI_Rn02_00399589 predicted 1044
5 SASI_Rn02_00399590 predicted 1747
6 SASI_Rn02_00399591 predicted 5016
7 SASI_Rn02_00399592 predicted 4568
8 SASI_Rn02_00399593 predicted 5621
9 SASI_Rn02_00399594 predicted 1881
10 SASI_Rn02_00399595 predicted 3321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293523 predicted 584
2 SASI_Mm02_00293524 predicted 3822
3 SASI_Mm02_00293525 predicted 2474
4 SASI_Mm02_00293526 predicted 1584
5 SASI_Mm02_00293527 predicted 352
6 SASI_Mm02_00293528 predicted 4678
7 SASI_Mm02_00293529 predicted 1743
8 SASI_Mm02_00293530 predicted 5014
9 SASI_Mm02_00293531 predicted 777
10 SASI_Mm02_00293532 predicted 5924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229256 predicted 5045
2 SASI_Mm01_00229257 predicted 2623
3 SASI_Mm01_00229258 predicted 3113
4 SASI_Mm01_00229259 predicted 1774
5 SASI_Mm01_00229260 predicted 887
6 SASI_Mm01_00229261 predicted 3875
7 SASI_Mm01_00229262 predicted 3972
8 SASI_Mm01_00229263 predicted 1045
9 SASI_Mm01_00229264 predicted 5155
10 SASI_Mm01_00229265 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228840 predicted 589
2 SASI_Mm01_00228841 predicted 5803
3 SASI_Mm01_00228842 predicted 3330
4 SASI_Mm01_00228843 predicted 3820
5 SASI_Mm01_00228844 predicted 2478
6 SASI_Mm01_00228845 predicted 1591
7 SASI_Mm01_00228846 predicted 354
8 SASI_Mm01_00228847 predicted 4680
9 SASI_Mm01_00228848 predicted 1745
10 SASI_Mm01_00228849 predicted 5017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245650 predicted 3797
2 SASI_Mm01_00245651 predicted 2504
3 SASI_Mm01_00245652 predicted 2958
4 SASI_Mm01_00245653 predicted 2388
5 SASI_Mm01_00245654 predicted 2059
6 SASI_Mm01_00245655 predicted 3775
7 SASI_Mm01_00245656 predicted 2222
8 SASI_Mm01_00245657 predicted 2515
9 SASI_Mm01_00245658 predicted 3039
10 SASI_Mm01_00245659 predicted 2864
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221864 predicted 3412
2 SASI_Mm01_00221865 predicted 3321
3 SASI_Mm01_00221866 predicted 846
4 SASI_Mm01_00221867 predicted 1341
5 SASI_Mm01_00221868 predicted 2093
6 SASI_Mm01_00221869 predicted 3063
7 SASI_Mm01_00221870 predicted 2199
8 SASI_Mm01_00221871 predicted 2878
9 SASI_Mm01_00221872 predicted 2536
10 SASI_Mm01_00221873 predicted 3440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281610 predicted 2264
2 SASI_Mm01_00281611 predicted 2171
3 SASI_Mm01_00281612 predicted 2303
4 SASI_Mm01_00281613 predicted 1703
5 SASI_Mm01_00281614 predicted 1922
6 SASI_Mm01_00281615 predicted 1614
7 SASI_Mm01_00281616 predicted 1056
8 SASI_Mm01_00281617 predicted 1741
9 SASI_Mm01_00281618 predicted 1382
10 SASI_Mm01_00281619 predicted 2292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003972
VALIDATED
BTAF1 MISSION shRNA Bacterial Glycerol Stock
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003972.2-1713s21c1
Sequence:CCGGGAAACTCTGTTTACGTTATTACTCGAGTAATAACGTAAACAGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-3606s21c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003972.2-5947s21c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-468s21c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-5344s21c1
Sequence:CCGGTTAACGTATACCGATTGATAACTCGAGTTATCAATCGGTATACGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-3625s1c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003972.1-487s1c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-5189s1c1
Sequence:CCGGCCCGGTTTAATAATGATCCATCTCGAGATGGATCATTATTAAACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-4118s1c1
Sequence:CCGGCGCCAACATTAACAGGCCATTCTCGAGAATGGCCTGTTAATGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003972.1-5966s1c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003972
VALIDATED
BTAF1 MISSION shRNA shRNA Plasmid DNA
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003972.2-1713s21c1
Sequence:CCGGGAAACTCTGTTTACGTTATTACTCGAGTAATAACGTAAACAGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-3606s21c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003972.2-5947s21c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-468s21c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-5344s21c1
Sequence:CCGGTTAACGTATACCGATTGATAACTCGAGTTATCAATCGGTATACGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-3625s1c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003972.1-487s1c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-5189s1c1
Sequence:CCGGCCCGGTTTAATAATGATCCATCTCGAGATGGATCATTATTAAACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-4118s1c1
Sequence:CCGGCGCCAACATTAACAGGCCATTCTCGAGAATGGCCTGTTAATGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003972.1-5966s1c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003972
VALIDATED
BTAF1 MISSION shRNA Lentiviral Transduction Particles
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003972.2-1713s21c1
Sequence:CCGGGAAACTCTGTTTACGTTATTACTCGAGTAATAACGTAAACAGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-3606s21c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003972.2-5947s21c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-468s21c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003972.2-5344s21c1
Sequence:CCGGTTAACGTATACCGATTGATAACTCGAGTTATCAATCGGTATACGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-3625s1c1
Sequence:CCGGGCCTGTGTAATGGAACAACTACTCGAGTAGTTGTTCCATTACACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003972.1-487s1c1
Sequence:CCGGGCCGAATTTGAAGTCCAAGATCTCGAGATCTTGGACTTCAAATTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-5189s1c1
Sequence:CCGGCCCGGTTTAATAATGATCCATCTCGAGATGGATCATTATTAAACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003972.1-4118s1c1
Sequence:CCGGCGCCAACATTAACAGGCCATTCTCGAGAATGGCCTGTTAATGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003972.1-5966s1c1
Sequence:CCGGCCTCCTATCTTTAGTCACTTTCTCGAGAAAGTGACTAAAGATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080706
VALIDATED
BTAF1 MISSION shRNA Bacterial Glycerol Stock
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4576s21c1
Sequence:CCGGACTGCTAATTACAGGATTATTCTCGAGAATAATCCTGTAATTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-5900s21c1
Sequence:CCGGAGTTACCTTCTGCTGATATTCCTCGAGGAATATCAGCAGAAGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-730s21c1
Sequence:CCGGATAGCACGCCAACGGAAATTACTCGAGTAATTTCCGTTGGCGTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080706.1-591s21c1
Sequence:CCGGATCTACTACAGATCGATTAAACTCGAGTTTAATCGATCTGTAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4696s21c1
Sequence:CCGGCGATATGGCAAACCTATATTACTCGAGTAATATAGGTTTGCCATATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080706
VALIDATED
BTAF1 MISSION shRNA shRNA Plasmid DNA
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4576s21c1
Sequence:CCGGACTGCTAATTACAGGATTATTCTCGAGAATAATCCTGTAATTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-5900s21c1
Sequence:CCGGAGTTACCTTCTGCTGATATTCCTCGAGGAATATCAGCAGAAGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-730s21c1
Sequence:CCGGATAGCACGCCAACGGAAATTACTCGAGTAATTTCCGTTGGCGTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080706.1-591s21c1
Sequence:CCGGATCTACTACAGATCGATTAAACTCGAGTTTAATCGATCTGTAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4696s21c1
Sequence:CCGGCGATATGGCAAACCTATATTACTCGAGTAATATAGGTTTGCCATATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080706
VALIDATED
BTAF1 MISSION shRNA Lentiviral Transduction Particles
BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4576s21c1
Sequence:CCGGACTGCTAATTACAGGATTATTCTCGAGAATAATCCTGTAATTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-5900s21c1
Sequence:CCGGAGTTACCTTCTGCTGATATTCCTCGAGGAATATCAGCAGAAGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-730s21c1
Sequence:CCGGATAGCACGCCAACGGAAATTACTCGAGTAATTTCCGTTGGCGTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080706.1-591s21c1
Sequence:CCGGATCTACTACAGATCGATTAAACTCGAGTTTAATCGATCTGTAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080706.1-4696s21c1
Sequence:CCGGCGATATGGCAAACCTATATTACTCGAGTAATATAGGTTTGCCATATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)