EMAIL THIS PAGE TO A FRIEND

BTBD10

BTB (POZ) domain containing 10

125 Gene Product Result for
Synonyms: GMRP-1 GMRP1
UniProtKB ID: Q9BSF8, Q86WG1
Gene ID:
Mouse(68815) BTB (POZ) domain containing 10
Rat(308890) BTB (POZ) domain containing 10
naked mole-rat(101719387) BTB (POZ) domain containing 10
domestic guinea pig(100713347) BTB (POZ) domain containing 10
sheep(101120519) BTB (POZ) domain containing 10
chicken(423029) BTB (POZ) domain containing 10
dog(476861) BTB (POZ) domain containing 10
Horse(100056058) BTB (POZ) domain containing 10
cow(505888) BTB (POZ) domain containing 10
domestic cat(101092461) BTB (POZ) domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111191 MISSION® esiRNA esiRNA human BTBD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032320 Rosetta Predictions human pricing
NM_001014022 Rosetta Predictions rat pricing
NM_133700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085675 predicted 1001
2 SASI_Hs02_00359673 predicted 891
3 SASI_Hs01_00085676 predicted 1335
4 SASI_Hs02_00359674 predicted 889
5 SASI_Hs01_00085678 predicted 401
6 SASI_Hs01_00085679 predicted 461
7 SASI_Hs01_00085680 predicted 433
8 SASI_Hs01_00085681 predicted 1310
9 SASI_Hs01_00085682 predicted 769
10 SASI_Hs02_00359675 predicted 788
11 SASI_Hs01_00085673 predicted 1508
12 SASI_Hs01_00085674 predicted 1450
13 SASI_Hs01_00085677 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107479 predicted 822
2 SASI_Rn01_00107480 predicted 884
3 SASI_Rn01_00107482 predicted 1129
4 SASI_Rn01_00107483 predicted 1047
5 SASI_Rn01_00107484 predicted 276
6 SASI_Rn01_00107485 predicted 1256
7 SASI_Rn01_00107486 predicted 1161
8 SASI_Rn01_00107487 predicted 1303
9 SASI_Rn01_00107488 predicted 885
10 SASI_Rn02_00201405 predicted 287
11 SASI_Rn01_00107481 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065869 predicted 586
2 SASI_Mm01_00065870 predicted 1154
3 SASI_Mm01_00065871 predicted 550
4 SASI_Mm01_00065872 predicted 1783
5 SASI_Mm02_00338656 predicted 1395
6 SASI_Mm01_00065875 predicted 1612
7 SASI_Mm01_00065876 predicted 860
8 SASI_Mm01_00065877 predicted 658
9 SASI_Mm01_00065878 predicted 1537
10 SASI_Mm02_00338657 predicted 556
11 SASI_Mm01_00065873 predicted 1586
12 SASI_Mm01_00065874 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032320
VALIDATED
BTBD10 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-303s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-470s21c1
Sequence:CCGGACGAGATTCATCTCATGAAAGCTCGAGCTTTCATGAGATGAATCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2107s21c1
Sequence:CCGGTATAGTTGTGATGCACAATATCTCGAGATATTGTGCATCACAACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-934s21c1
Sequence:CCGGGAGCGATTCTGGATTACTATACTCGAGTATAGTAATCCAGAATCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-355s21c1
Sequence:CCGGCAAGTACTTCCTCGCGTATTGCTCGAGCAATACGCGAGGAAGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2149s21c1
Sequence:CCGGGTATTCCTCCAGTACAATTTGCTCGAGCAAATTGTACTGGAGGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-746s1c1
Sequence:CCGGGAGTGACACTAATAGTGGATACTCGAGTATCCACTATTAGTGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-638s1c1
Sequence:CCGGGAAACAGTAGTCAGTCAAGTTCTCGAGAACTTGACTGACTACTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032320.4-1769s1c1
Sequence:CCGGGCACATAACAATGTTTAGGATCTCGAGATCCTAAACATTGTTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032320.4-1357s1c1
Sequence:CCGGGAAGGTTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032320
VALIDATED
BTBD10 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-303s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-470s21c1
Sequence:CCGGACGAGATTCATCTCATGAAAGCTCGAGCTTTCATGAGATGAATCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2107s21c1
Sequence:CCGGTATAGTTGTGATGCACAATATCTCGAGATATTGTGCATCACAACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-934s21c1
Sequence:CCGGGAGCGATTCTGGATTACTATACTCGAGTATAGTAATCCAGAATCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-355s21c1
Sequence:CCGGCAAGTACTTCCTCGCGTATTGCTCGAGCAATACGCGAGGAAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2149s21c1
Sequence:CCGGGTATTCCTCCAGTACAATTTGCTCGAGCAAATTGTACTGGAGGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-746s1c1
Sequence:CCGGGAGTGACACTAATAGTGGATACTCGAGTATCCACTATTAGTGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-638s1c1
Sequence:CCGGGAAACAGTAGTCAGTCAAGTTCTCGAGAACTTGACTGACTACTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032320.4-1769s1c1
Sequence:CCGGGCACATAACAATGTTTAGGATCTCGAGATCCTAAACATTGTTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032320.4-1357s1c1
Sequence:CCGGGAAGGTTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032320
VALIDATED
BTBD10 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-303s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-470s21c1
Sequence:CCGGACGAGATTCATCTCATGAAAGCTCGAGCTTTCATGAGATGAATCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2107s21c1
Sequence:CCGGTATAGTTGTGATGCACAATATCTCGAGATATTGTGCATCACAACTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-934s21c1
Sequence:CCGGGAGCGATTCTGGATTACTATACTCGAGTATAGTAATCCAGAATCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032320.5-355s21c1
Sequence:CCGGCAAGTACTTCCTCGCGTATTGCTCGAGCAATACGCGAGGAAGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032320.5-2149s21c1
Sequence:CCGGGTATTCCTCCAGTACAATTTGCTCGAGCAAATTGTACTGGAGGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-746s1c1
Sequence:CCGGGAGTGACACTAATAGTGGATACTCGAGTATCCACTATTAGTGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032320.4-638s1c1
Sequence:CCGGGAAACAGTAGTCAGTCAAGTTCTCGAGAACTTGACTGACTACTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032320.4-1769s1c1
Sequence:CCGGGCACATAACAATGTTTAGGATCTCGAGATCCTAAACATTGTTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032320.4-1357s1c1
Sequence:CCGGGAAGGTTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133700
VALIDATED
BTBD10 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-1015s21c1
Sequence:CCGGCTACTGTGTTTCGAGCTATTTCTCGAGAAATAGCTCGAAACACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-627s21c1
Sequence:CCGGCCAACAAGGCAGCATCATATTCTCGAGAATATGATGCTGCCTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-396s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-2191s21c1
Sequence:CCGGGTGATGCACAGTATAACATAACTCGAGTTATGTTATACTGTGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-597s21c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-597s1c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-396s1c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133700.1-1953s1c1
Sequence:CCGGGCATCCTCGTTCGAGTTCTATCTCGAGATAGAACTCGAACGAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1105s1c1
Sequence:CCGGGTGATTACCTTTGTATCTCTTCTCGAGAAGAGATACAAAGGTAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1464s1c1
Sequence:CCGGGAAGGCTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133700
VALIDATED
BTBD10 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-1015s21c1
Sequence:CCGGCTACTGTGTTTCGAGCTATTTCTCGAGAAATAGCTCGAAACACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-627s21c1
Sequence:CCGGCCAACAAGGCAGCATCATATTCTCGAGAATATGATGCTGCCTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-396s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-2191s21c1
Sequence:CCGGGTGATGCACAGTATAACATAACTCGAGTTATGTTATACTGTGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-597s21c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-597s1c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-396s1c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133700.1-1953s1c1
Sequence:CCGGGCATCCTCGTTCGAGTTCTATCTCGAGATAGAACTCGAACGAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1105s1c1
Sequence:CCGGGTGATTACCTTTGTATCTCTTCTCGAGAAGAGATACAAAGGTAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1464s1c1
Sequence:CCGGGAAGGCTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133700
VALIDATED
BTBD10 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-1015s21c1
Sequence:CCGGCTACTGTGTTTCGAGCTATTTCTCGAGAAATAGCTCGAAACACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-627s21c1
Sequence:CCGGCCAACAAGGCAGCATCATATTCTCGAGAATATGATGCTGCCTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133700.2-396s21c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-2191s21c1
Sequence:CCGGGTGATGCACAGTATAACATAACTCGAGTTATGTTATACTGTGCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133700.2-597s21c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-597s1c1
Sequence:CCGGCTTACTCCTTGTATTCGAAATCTCGAGATTTCGAATACAAGGAGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.2-396s1c1
Sequence:CCGGGAGAATTGGGATCGGAAATTGCTCGAGCAATTTCCGATCCCAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133700.1-1953s1c1
Sequence:CCGGGCATCCTCGTTCGAGTTCTATCTCGAGATAGAACTCGAACGAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1105s1c1
Sequence:CCGGGTGATTACCTTTGTATCTCTTCTCGAGAAGAGATACAAAGGTAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133700.1-1464s1c1
Sequence:CCGGGAAGGCTATCCTACCTACAAACTCGAGTTTGTAGGTAGGATAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)