EMAIL THIS PAGE TO A FRIEND

BTBD11

BTB (POZ) domain containing 11

208 Gene Product Result for
Gene ID:
Mouse(74007) BTB (POZ) domain containing 11
Rat(314675) BTB (POZ) domain containing 11
chicken(771493) BTB (POZ) domain containing 11
dog(481292) BTB (POZ) domain containing 11
domestic cat(101090369) BTB (POZ) domain containing 11
cow(539986) BTB (POZ) domain containing 11
Horse(100054002) BTB (POZ) domain containing 11
sheep(101103558) BTB (POZ) domain containing 11
domestic guinea pig(100714346) BTB (POZ) domain containing 11
naked mole-rat(101718880) BTB (POZ) domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055898 Anti-BTBD11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001018072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001018072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001018072 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082991 MISSION® esiRNA esiRNA human BTBD11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017523 Rosetta Predictions human pricing
NM_001018072 Rosetta Predictions human pricing
NM_152322 Rosetta Predictions human pricing
NM_001108078 Rosetta Predictions rat pricing
NM_001017525 Rosetta Predictions mouse pricing
NM_028709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306779 predicted 554
2 SASI_Hs01_00089914 predicted 1564
3 SASI_Hs01_00089916 predicted 1753
4 SASI_Hs02_00306780 predicted 798
5 SASI_Hs02_00306781 predicted 1441
6 SASI_Hs01_00089917 predicted 1583
7 SASI_Hs02_00306782 predicted 635
8 SASI_Hs02_00306783 predicted 1534
9 SASI_Hs02_00306784 predicted 443
10 SASI_Hs02_00306785 predicted 1361
11 SASI_Hs01_00089910 predicted 1690
12 SASI_Hs01_00089911 predicted 1912
13 SASI_Hs01_00089912 predicted 2154
14 SASI_Hs01_00089913 predicted 1538
15 SASI_Hs01_00089915 predicted 2081
16 SASI_Hs01_00089918 predicted 2263
17 SASI_Hs01_00089919 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306965 predicted 2413
2 SASI_Hs01_00095362 predicted 3427
3 SASI_Hs01_00095364 predicted 3619
4 SASI_Hs02_00306966 predicted 2657
5 SASI_Hs02_00306967 predicted 3299
6 SASI_Hs01_00095365 predicted 3439
7 SASI_Hs02_00306968 predicted 2497
8 SASI_Hs02_00306969 predicted 3402
9 SASI_Hs02_00306970 predicted 2304
10 SASI_Hs02_00306971 predicted 3219
11 SASI_Hs01_00095358 predicted 3550
12 SASI_Hs01_00095359 predicted 3766
13 SASI_Hs01_00095360 predicted 4015
14 SASI_Hs01_00095361 predicted 3406
15 SASI_Hs01_00095363 predicted 3943
16 SASI_Hs01_00095366 predicted 4119
17 SASI_Hs01_00095367 predicted 3476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161025 predicted 518
2 SASI_Hs01_00161026 predicted 749
3 SASI_Hs01_00161027 predicted 992
4 SASI_Hs01_00161028 predicted 379
5 SASI_Hs01_00161029 predicted 405
6 SASI_Hs01_00161030 predicted 921
7 SASI_Hs01_00161031 predicted 596
8 SASI_Hs01_00161032 predicted 414
9 SASI_Hs01_00161033 predicted 1097
10 SASI_Hs01_00161034 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235134 predicted 1288
2 SASI_Rn02_00235135 predicted 805
3 SASI_Rn02_00235136 predicted 763
4 SASI_Rn02_00235137 predicted 1283
5 SASI_Rn02_00235138 predicted 837
6 SASI_Rn02_00235139 predicted 1005
7 SASI_Rn02_00235140 predicted 758
8 SASI_Rn02_00235141 predicted 1135
9 SASI_Rn02_00235142 predicted 647
10 SASI_Rn02_00235143 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060119 predicted 622
2 SASI_Mm01_00060120 predicted 572
3 SASI_Mm01_00060121 predicted 1097
4 SASI_Mm01_00060122 predicted 579
5 SASI_Mm01_00060123 predicted 1099
6 SASI_Mm01_00060124 predicted 1733
7 SASI_Mm01_00060125 predicted 811
8 SASI_Mm02_00287518 predicted 1932
9 SASI_Mm01_00060127 predicted 1277
10 SASI_Mm01_00060128 predicted 1743
11 SASI_Mm01_00060126 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048343 predicted 1467
2 SASI_Mm01_00048344 predicted 1420
3 SASI_Mm01_00048345 predicted 1945
4 SASI_Mm01_00048346 predicted 1425
5 SASI_Mm01_00048347 predicted 1955
6 SASI_Mm01_00048348 predicted 2585
7 SASI_Mm01_00048349 predicted 1663
8 SASI_Mm02_00334246 predicted 2782
9 SASI_Mm01_00048351 predicted 2119
10 SASI_Mm01_00048352 predicted 2589
11 SASI_Mm01_00048350 predicted 2657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152322
VALIDATED
BTBD11 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-364s1c1
Sequence:CCGGGACAAATGATGGCACCTGCATCTCGAGATGCAGGTGCCATCATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-476s1c1
Sequence:CCGGGAGATCATGGAGCTTCTGTCTCTCGAGAGACAGAAGCTCCATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-680s1c1
Sequence:CCGGGCATTCAAGCAGCTCCTGTATCTCGAGATACAGGAGCTGCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152322.1-311s1c1
Sequence:CCGGGTGCTGTTATTTACAGCCTCTCTCGAGAGAGGCTGTAAATAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-598s1c1
Sequence:CCGGCAAGTTTCTTGGAGTCACAGACTCGAGTCTGTGACTCCAAGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-626s1c1
Sequence:CCGGGCATATTGCGAAGGCTACTTTCTCGAGAAAGTAGCCTTCGCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-449s1c1
Sequence:CCGGCCAGAGTCACTGCTCATTAAACTCGAGTTTAATGAGCAGTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-526s1c1
Sequence:CCGGGCAGCGACACTGTGAGATTATCTCGAGATAATCTCACAGTGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-592s1c1
Sequence:CCGGCCATGCCAAGTTTCTTGGAGTCTCGAGACTCCAAGAAACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-333s1c1
Sequence:CCGGCAAGGTTCAAAGCACTCCTCTCTCGAGAGAGGAGTGCTTTGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152322
VALIDATED
BTBD11 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-364s1c1
Sequence:CCGGGACAAATGATGGCACCTGCATCTCGAGATGCAGGTGCCATCATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-476s1c1
Sequence:CCGGGAGATCATGGAGCTTCTGTCTCTCGAGAGACAGAAGCTCCATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-680s1c1
Sequence:CCGGGCATTCAAGCAGCTCCTGTATCTCGAGATACAGGAGCTGCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152322.1-311s1c1
Sequence:CCGGGTGCTGTTATTTACAGCCTCTCTCGAGAGAGGCTGTAAATAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-598s1c1
Sequence:CCGGCAAGTTTCTTGGAGTCACAGACTCGAGTCTGTGACTCCAAGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-626s1c1
Sequence:CCGGGCATATTGCGAAGGCTACTTTCTCGAGAAAGTAGCCTTCGCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-449s1c1
Sequence:CCGGCCAGAGTCACTGCTCATTAAACTCGAGTTTAATGAGCAGTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-526s1c1
Sequence:CCGGGCAGCGACACTGTGAGATTATCTCGAGATAATCTCACAGTGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-592s1c1
Sequence:CCGGCCATGCCAAGTTTCTTGGAGTCTCGAGACTCCAAGAAACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-333s1c1
Sequence:CCGGCAAGGTTCAAAGCACTCCTCTCTCGAGAGAGGAGTGCTTTGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152322
VALIDATED
BTBD11 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-364s1c1
Sequence:CCGGGACAAATGATGGCACCTGCATCTCGAGATGCAGGTGCCATCATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-476s1c1
Sequence:CCGGGAGATCATGGAGCTTCTGTCTCTCGAGAGACAGAAGCTCCATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-680s1c1
Sequence:CCGGGCATTCAAGCAGCTCCTGTATCTCGAGATACAGGAGCTGCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152322.1-311s1c1
Sequence:CCGGGTGCTGTTATTTACAGCCTCTCTCGAGAGAGGCTGTAAATAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-598s1c1
Sequence:CCGGCAAGTTTCTTGGAGTCACAGACTCGAGTCTGTGACTCCAAGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-626s1c1
Sequence:CCGGGCATATTGCGAAGGCTACTTTCTCGAGAAAGTAGCCTTCGCAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152322.1-449s1c1
Sequence:CCGGCCAGAGTCACTGCTCATTAAACTCGAGTTTAATGAGCAGTGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152322.1-526s1c1
Sequence:CCGGGCAGCGACACTGTGAGATTATCTCGAGATAATCTCACAGTGTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-592s1c1
Sequence:CCGGCCATGCCAAGTTTCTTGGAGTCTCGAGACTCCAAGAAACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152322.1-333s1c1
Sequence:CCGGCAAGGTTCAAAGCACTCCTCTCTCGAGAGAGGAGTGCTTTGAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028709
BTBD11 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2655s1c1
Sequence:CCGGGCGTACTGTGAAGGCTACTTTCTCGAGAAAGTAGCCTTCACAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2426s1c1
Sequence:CCGGCGTGAAGTATCCCATCTTCCACTCGAGTGGAAGATGGGATACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-1946s21c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-853s21c1
Sequence:CCGGATGCGAAGCACCACGGTAATGCTCGAGCATTACCGTGGTGCTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-1946s1c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028709.1-3383s21c1
Sequence:CCGGGTCTCGTAGTTTCGAATATATCTCGAGATATATTCGAAACTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-2125s21c1
Sequence:CCGGCCCTGATGTTTGAGATCTTAACTCGAGTTAAGATCTCAAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-542s21c1
Sequence:CCGGGCTTCACGAAGCGCCCAAATTCTCGAGAATTTGGGCGCTTCGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028709
BTBD11 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2655s1c1
Sequence:CCGGGCGTACTGTGAAGGCTACTTTCTCGAGAAAGTAGCCTTCACAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2426s1c1
Sequence:CCGGCGTGAAGTATCCCATCTTCCACTCGAGTGGAAGATGGGATACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-1946s21c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-853s21c1
Sequence:CCGGATGCGAAGCACCACGGTAATGCTCGAGCATTACCGTGGTGCTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-1946s1c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028709.1-3383s21c1
Sequence:CCGGGTCTCGTAGTTTCGAATATATCTCGAGATATATTCGAAACTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-2125s21c1
Sequence:CCGGCCCTGATGTTTGAGATCTTAACTCGAGTTAAGATCTCAAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-542s21c1
Sequence:CCGGGCTTCACGAAGCGCCCAAATTCTCGAGAATTTGGGCGCTTCGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028709
BTBD11 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2655s1c1
Sequence:CCGGGCGTACTGTGAAGGCTACTTTCTCGAGAAAGTAGCCTTCACAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-2426s1c1
Sequence:CCGGCGTGAAGTATCCCATCTTCCACTCGAGTGGAAGATGGGATACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-1946s21c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-853s21c1
Sequence:CCGGATGCGAAGCACCACGGTAATGCTCGAGCATTACCGTGGTGCTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028709.1-1946s1c1
Sequence:CCGGCGTGGATGTCACAATTGATATCTCGAGATATCAATTGTGACATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028709.1-3383s21c1
Sequence:CCGGGTCTCGTAGTTTCGAATATATCTCGAGATATATTCGAAACTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-2125s21c1
Sequence:CCGGCCCTGATGTTTGAGATCTTAACTCGAGTTAAGATCTCAAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028709.1-542s21c1
Sequence:CCGGGCTTCACGAAGCGCCCAAATTCTCGAGAATTTGGGCGCTTCGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018072
BTBD11 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 11
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000435046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4244s21c1
Sequence:CCGGACGTCAACCATGGTAGCAAATCTCGAGATTTGCTACCATGGTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018072.1-3040s21c1
Sequence:CCGGCTCTCATCCAGTGCTTGTTAACTCGAGTTAACAAGCACTGGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4288s21c1
Sequence:CCGGAGGAAATAATCTGGCAAATTTCTCGAGAAATTTGCCAGATTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018072
BTBD11 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 11
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000435046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4244s21c1
Sequence:CCGGACGTCAACCATGGTAGCAAATCTCGAGATTTGCTACCATGGTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018072.1-3040s21c1
Sequence:CCGGCTCTCATCCAGTGCTTGTTAACTCGAGTTAACAAGCACTGGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4288s21c1
Sequence:CCGGAGGAAATAATCTGGCAAATTTCTCGAGAAATTTGCCAGATTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018072
BTBD11 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 11
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000435046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4244s21c1
Sequence:CCGGACGTCAACCATGGTAGCAAATCTCGAGATTTGCTACCATGGTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018072.1-3040s21c1
Sequence:CCGGCTCTCATCCAGTGCTTGTTAACTCGAGTTAACAAGCACTGGATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001018072.1-4288s21c1
Sequence:CCGGAGGAAATAATCTGGCAAATTTCTCGAGAAATTTGCCAGATTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks