EMAIL THIS PAGE TO A FRIEND

BTBD16

BTB (POZ) domain containing 16

73 Gene Product Result for
Synonyms: C10orf87
UniProtKB ID: Q32M84, A6NM63, Q4VXL1, Q96LN0
Gene ID:
Mouse(330660) BTB (POZ) domain containing 16
Rat(361658) BTB (POZ) domain containing 16
Zebrafish(565632) BTB (POZ) domain containing 16
cow(518515) BTB (POZ) domain containing 16
Horse(100064634) BTB (POZ) domain containing 16
domestic cat(101095685) BTB (POZ) domain containing 16
dog(486920) BTB (POZ) domain containing 16
naked mole-rat(101705342) BTB (POZ) domain containing 16
domestic guinea pig(100716512) BTB (POZ) domain containing 16
sheep(101110555) BTB (POZ) domain containing 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144587 Rosetta Predictions human pricing
NM_001017464 Rosetta Predictions rat pricing
NM_001081038 Rosetta Predictions mouse pricing
XM_001004558 Rosetta Predictions mouse pricing
XM_001004560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192588 predicted 1308
2 SASI_Hs01_00192589 predicted 1408
3 SASI_Hs01_00192590 predicted 373
4 SASI_Hs01_00192591 predicted 1033
5 SASI_Hs01_00192592 predicted 1171
6 SASI_Hs01_00192593 predicted 766
7 SASI_Hs01_00192594 predicted 1437
8 SASI_Hs01_00192595 predicted 1381
9 SASI_Hs01_00192596 predicted 677
10 SASI_Hs01_00192597 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030131 predicted 823
2 SASI_Rn01_00030132 predicted 1348
3 SASI_Rn02_00202264 predicted 1197
4 SASI_Rn02_00202265 predicted 1078
5 SASI_Rn01_00030134 predicted 1261
6 SASI_Rn01_00030136 predicted 1409
7 SASI_Rn02_00202266 predicted 1338
8 SASI_Rn01_00030137 predicted 1426
9 SASI_Rn01_00030138 predicted 1458
10 SASI_Rn01_00030139 predicted 864
11 SASI_Rn01_00030133 predicted 978
12 SASI_Rn01_00030135 predicted 932
13 SASI_Rn01_00030140 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294571 predicted 1494
2 SASI_Mm02_00294572 predicted 1338
3 SASI_Mm02_00294573 predicted 1090
4 SASI_Mm02_00294574 predicted 715
5 SASI_Mm02_00294575 predicted 352
6 SASI_Mm02_00294576 predicted 1078
7 SASI_Mm02_00294577 predicted 537
8 SASI_Mm02_00294578 predicted 1177
9 SASI_Mm02_00294579 predicted 1116
10 SASI_Mm02_00294580 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210688 predicted 354
2 SASI_Mm01_00210689 predicted 389
3 SASI_Mm01_00210690 predicted 875
4 SASI_Mm01_00210691 predicted 719
5 SASI_Mm01_00210692 predicted 366
6 SASI_Mm01_00210693 predicted 953
7 SASI_Mm01_00210694 predicted 538
8 SASI_Mm01_00210695 predicted 1024
9 SASI_Mm01_00210696 predicted 447
10 SASI_Mm01_00210697 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228917 predicted 1507
2 SASI_Mm01_00228918 predicted 1337
3 SASI_Mm01_00228919 predicted 1100
4 SASI_Mm01_00228920 predicted 726
5 SASI_Mm01_00228921 predicted 367
6 SASI_Mm01_00228922 predicted 1085
7 SASI_Mm01_00228923 predicted 544
8 SASI_Mm01_00228924 predicted 1183
9 SASI_Mm01_00228925 predicted 1125
10 SASI_Mm01_00228926 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144587
BTBD16 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-841s21c1
Sequence:CCGGGGTGCGTGGATGTGATGATAGCTCGAGCTATCATCACATCCACGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-756s21c1
Sequence:CCGGATGAGTGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1359s21c1
Sequence:CCGGGTCCACCTGAAAGATCTTAACCTCGAGGTTAAGATCTTTCAGGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1099s21c1
Sequence:CCGGTGCAACTGAACTACAAGATTCCTCGAGGAATCTTGTAGTTCAGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-632s1c1
Sequence:CCGGGCGAGCTCAATCACCTAAGAACTCGAGTTCTTAGGTGATTGAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1132s1c1
Sequence:CCGGCTTATGAAACCGTGATGACATCTCGAGATGTCATCACGGTTTCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-378s1c1
Sequence:CCGGCTGAGCATAGACTTTGAGGAACTCGAGTTCCTCAAAGTCTATGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1401s1c1
Sequence:CCGGCTGCTCTTTAACCAGGAGAATCTCGAGATTCTCCTGGTTAAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1443s1c1
Sequence:CCGGGCTCTATATGGATTCTTCTTTCTCGAGAAAGAAGAATCCATATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144587
BTBD16 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-841s21c1
Sequence:CCGGGGTGCGTGGATGTGATGATAGCTCGAGCTATCATCACATCCACGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-756s21c1
Sequence:CCGGATGAGTGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1359s21c1
Sequence:CCGGGTCCACCTGAAAGATCTTAACCTCGAGGTTAAGATCTTTCAGGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1099s21c1
Sequence:CCGGTGCAACTGAACTACAAGATTCCTCGAGGAATCTTGTAGTTCAGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-632s1c1
Sequence:CCGGGCGAGCTCAATCACCTAAGAACTCGAGTTCTTAGGTGATTGAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1132s1c1
Sequence:CCGGCTTATGAAACCGTGATGACATCTCGAGATGTCATCACGGTTTCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-378s1c1
Sequence:CCGGCTGAGCATAGACTTTGAGGAACTCGAGTTCCTCAAAGTCTATGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1401s1c1
Sequence:CCGGCTGCTCTTTAACCAGGAGAATCTCGAGATTCTCCTGGTTAAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1443s1c1
Sequence:CCGGGCTCTATATGGATTCTTCTTTCTCGAGAAAGAAGAATCCATATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144587
BTBD16 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-841s21c1
Sequence:CCGGGGTGCGTGGATGTGATGATAGCTCGAGCTATCATCACATCCACGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-756s21c1
Sequence:CCGGATGAGTGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1359s21c1
Sequence:CCGGGTCCACCTGAAAGATCTTAACCTCGAGGTTAAGATCTTTCAGGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144587.2-1099s21c1
Sequence:CCGGTGCAACTGAACTACAAGATTCCTCGAGGAATCTTGTAGTTCAGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-632s1c1
Sequence:CCGGGCGAGCTCAATCACCTAAGAACTCGAGTTCTTAGGTGATTGAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1132s1c1
Sequence:CCGGCTTATGAAACCGTGATGACATCTCGAGATGTCATCACGGTTTCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-378s1c1
Sequence:CCGGCTGAGCATAGACTTTGAGGAACTCGAGTTCCTCAAAGTCTATGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1401s1c1
Sequence:CCGGCTGCTCTTTAACCAGGAGAATCTCGAGATTCTCCTGGTTAAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144587.2-1443s1c1
Sequence:CCGGGCTCTATATGGATTCTTCTTTCTCGAGAAAGAAGAATCCATATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081038
BTBD16 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1570s21c1
Sequence:CCGGCTCGGAAAGGATTTCTATATACTCGAGTATATAGAAATCCTTTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081038.1-2167s21c1
Sequence:CCGGGACCTTAGCAGCTACTAATTGCTCGAGCAATTAGTAGCTGCTAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-955s21c1
Sequence:CCGGCCTCCAGTTCAACCGACTATTCTCGAGAATAGTCGGTTGAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1592s21c1
Sequence:CCGGGGATACTTCTTTGAGATAAAGCTCGAGCTTTATCTCAAAGAAGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-810s21c1
Sequence:CCGGCTGTAAAGAAGATCATCATTTCTCGAGAAATGATGATCTTCTTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081038
BTBD16 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1570s21c1
Sequence:CCGGCTCGGAAAGGATTTCTATATACTCGAGTATATAGAAATCCTTTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081038.1-2167s21c1
Sequence:CCGGGACCTTAGCAGCTACTAATTGCTCGAGCAATTAGTAGCTGCTAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-955s21c1
Sequence:CCGGCCTCCAGTTCAACCGACTATTCTCGAGAATAGTCGGTTGAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1592s21c1
Sequence:CCGGGGATACTTCTTTGAGATAAAGCTCGAGCTTTATCTCAAAGAAGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-810s21c1
Sequence:CCGGCTGTAAAGAAGATCATCATTTCTCGAGAAATGATGATCTTCTTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081038
BTBD16 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1570s21c1
Sequence:CCGGCTCGGAAAGGATTTCTATATACTCGAGTATATAGAAATCCTTTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081038.1-2167s21c1
Sequence:CCGGGACCTTAGCAGCTACTAATTGCTCGAGCAATTAGTAGCTGCTAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-955s21c1
Sequence:CCGGCCTCCAGTTCAACCGACTATTCTCGAGAATAGTCGGTTGAACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-1592s21c1
Sequence:CCGGGGATACTTCTTTGAGATAAAGCTCGAGCTTTATCTCAAAGAAGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081038.1-810s21c1
Sequence:CCGGCTGTAAAGAAGATCATCATTTCTCGAGAAATGATGATCTTCTTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)