EMAIL THIS PAGE TO A FRIEND

BTBD17

BTB (POZ) domain containing 17

54 Gene Product Result for
Synonyms: BTBD17A LGALS3BPL TANGO10A
UniProtKB ID: A6NE02
Gene ID:
Mouse(72014) BTB (POZ) domain containing 17
Rat(303660) BTB (POZ) domain containing 17
sheep(101105933) BTB (POZ) domain containing 17
domestic guinea pig(100734418) BTB (POZ) domain containing 17
naked mole-rat(101722142) BTB (POZ) domain containing 17
chicken(427813) BTB (POZ) domain containing 17
dog(483286) BTB (POZ) domain containing 17
cow(789790) BTB (POZ) domain containing 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080466 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085091 MISSION® esiRNA esiRNA targeting mouse Btbd17 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080466 Rosetta Predictions human pricing
XM_371078 Rosetta Predictions human pricing
NM_001134534 Rosetta Predictions rat pricing
NM_028055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315106 predicted 1347
2 SASI_Hs02_00315107 predicted 212
3 SASI_Hs02_00315108 predicted 899
4 SASI_Hs02_00315109 predicted 211
5 SASI_Hs02_00315110 predicted 1401
6 SASI_Hs02_00315111 predicted 1384
7 SASI_Hs02_00315112 predicted 1389
8 SASI_Hs02_00315113 predicted 419
9 SASI_Hs02_00315114 predicted 278
10 SASI_Hs02_00315115 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291983 predicted 1350
2 SASI_Hs01_00291984 predicted 217
3 SASI_Hs01_00291985 predicted 905
4 SASI_Hs01_00291986 predicted 220
5 SASI_Hs01_00291987 predicted 1397
6 SASI_Hs01_00291988 predicted 1392
7 SASI_Hs01_00291989 predicted 1393
8 SASI_Hs01_00291990 predicted 425
9 SASI_Hs01_00291991 predicted 284
10 SASI_Hs01_00291992 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256829 predicted 1108
2 SASI_Rn02_00256830 predicted 1613
3 SASI_Rn02_00256831 predicted 1616
4 SASI_Rn02_00256832 predicted 1738
5 SASI_Rn02_00256833 predicted 364
6 SASI_Rn02_00256834 predicted 1728
7 SASI_Rn02_00256835 predicted 604
8 SASI_Rn02_00256836 predicted 1085
9 SASI_Rn02_00256837 predicted 2080
10 SASI_Rn02_00256838 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147322 predicted 1594
2 SASI_Mm02_00333248 predicted 1393
3 SASI_Mm01_00147323 predicted 498
4 SASI_Mm01_00147324 predicted 339
5 SASI_Mm01_00147325 predicted 926
6 SASI_Mm01_00147327 predicted 1211
7 SASI_Mm01_00147328 predicted 1935
8 SASI_Mm01_00147329 predicted 1476
9 SASI_Mm01_00147330 predicted 1917
10 SASI_Mm01_00147331 predicted 1098
11 SASI_Mm01_00147326 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484092
BTBD17 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-1419s1c1
Sequence:CCGGGCGCTGCATCTCCATCTCATTCTCGAGAATGAGATGGAGATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-933s1c1
Sequence:CCGGCCGTTGCATTACGCCAAGTTTCTCGAGAAACTTGGCGTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-395s1c1
Sequence:CCGGCAAGTTCATCAGGTATTTGTACTCGAGTACAAATACCTGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-338s1c1
Sequence:CCGGGAGCAACCAGAGTGAGGTTATCTCGAGATAACCTCACTCTGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484092.1-1657s1c1
Sequence:CCGGGCAGCATTCTTGGTACAGAATCTCGAGATTCTGTACCAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484092
BTBD17 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-1419s1c1
Sequence:CCGGGCGCTGCATCTCCATCTCATTCTCGAGAATGAGATGGAGATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-933s1c1
Sequence:CCGGCCGTTGCATTACGCCAAGTTTCTCGAGAAACTTGGCGTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-395s1c1
Sequence:CCGGCAAGTTCATCAGGTATTTGTACTCGAGTACAAATACCTGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-338s1c1
Sequence:CCGGGAGCAACCAGAGTGAGGTTATCTCGAGATAACCTCACTCTGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484092.1-1657s1c1
Sequence:CCGGGCAGCATTCTTGGTACAGAATCTCGAGATTCTGTACCAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484092
BTBD17 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-1419s1c1
Sequence:CCGGGCGCTGCATCTCCATCTCATTCTCGAGAATGAGATGGAGATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-933s1c1
Sequence:CCGGCCGTTGCATTACGCCAAGTTTCTCGAGAAACTTGGCGTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-395s1c1
Sequence:CCGGCAAGTTCATCAGGTATTTGTACTCGAGTACAAATACCTGATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484092.1-338s1c1
Sequence:CCGGGAGCAACCAGAGTGAGGTTATCTCGAGATAACCTCACTCTGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484092.1-1657s1c1
Sequence:CCGGGCAGCATTCTTGGTACAGAATCTCGAGATTCTGTACCAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080466
BTBD17 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-280s21c1
Sequence:CCGGTTCCTGGAGCTGCTAAGTAACCTCGAGGTTACTTAGCAGCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-1402s21c1
Sequence:CCGGCCCGTATACCACACCCTTATCCTCGAGGATAAGGGTGTGGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-219s21c1
Sequence:CCGGCACCGATGAGGTCCGGGTATTCTCGAGAATACCCGGACCTCATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080466.1-1451s21c1
Sequence:CCGGGAATAAAGGCCTGGCCTAGGTCTCGAGACCTAGGCCAGGCCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-338s21c1
Sequence:CCGGCCGCTGTCTTCGACAAGTTCACTCGAGTGAACTTGTCGAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080466
BTBD17 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-280s21c1
Sequence:CCGGTTCCTGGAGCTGCTAAGTAACCTCGAGGTTACTTAGCAGCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-1402s21c1
Sequence:CCGGCCCGTATACCACACCCTTATCCTCGAGGATAAGGGTGTGGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-219s21c1
Sequence:CCGGCACCGATGAGGTCCGGGTATTCTCGAGAATACCCGGACCTCATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080466.1-1451s21c1
Sequence:CCGGGAATAAAGGCCTGGCCTAGGTCTCGAGACCTAGGCCAGGCCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-338s21c1
Sequence:CCGGCCGCTGTCTTCGACAAGTTCACTCGAGTGAACTTGTCGAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080466
BTBD17 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-280s21c1
Sequence:CCGGTTCCTGGAGCTGCTAAGTAACCTCGAGGTTACTTAGCAGCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-1402s21c1
Sequence:CCGGCCCGTATACCACACCCTTATCCTCGAGGATAAGGGTGTGGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-219s21c1
Sequence:CCGGCACCGATGAGGTCCGGGTATTCTCGAGAATACCCGGACCTCATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080466.1-1451s21c1
Sequence:CCGGGAATAAAGGCCTGGCCTAGGTCTCGAGACCTAGGCCAGGCCTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080466.1-338s21c1
Sequence:CCGGCCGCTGTCTTCGACAAGTTCACTCGAGTGAACTTGTCGAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks