EMAIL THIS PAGE TO A FRIEND

BTBD18

BTB (POZ) domain containing 18

47 Gene Product Result for
UniProtKB ID: B2RXH4
Gene ID:
Rat(100363270) BTB (POZ) domain containing 18
chicken(101747829) BTB (POZ) domain containing 18
chicken(101666316) BTB (POZ) domain containing 18
cow(100298362) BTB (POZ) domain containing 18
Horse(100630130) BTB (POZ) domain containing 18
domestic cat(101087942) BTB (POZ) domain containing 18
dog(100688289) BTB (POZ) domain containing 18
naked mole-rat(101707949) BTB (POZ) domain containing 18
domestic guinea pig(100735160) BTB (POZ) domain containing 18
sheep(101122724) BTB (POZ) domain containing 18
Domestic Rabbit(100351890) BTB (POZ) domain containing 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145101 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220711 MISSION® esiRNA esiRNA targeting human BTBD18 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_926704 Rosetta Predictions human pricing
XR_041749 Rosetta Predictions human pricing
XR_041750 Rosetta Predictions human pricing
XR_041751 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257683 predicted 1531
2 SASI_Hs01_00257684 predicted 1767
3 SASI_Hs01_00257685 predicted 1507
4 SASI_Hs01_00257686 predicted 1909
5 SASI_Hs01_00257687 predicted 1318
6 SASI_Hs01_00257688 predicted 1576
7 SASI_Hs01_00257689 predicted 1727
8 SASI_Hs01_00257690 predicted 1230
9 SASI_Hs01_00257691 predicted 1096
10 SASI_Hs01_00257692 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530061 predicted 1677
2 SASI_Hs02_00530062 predicted 1808
3 SASI_Hs02_00530063 predicted 1618
4 SASI_Hs02_00530064 predicted 1856
5 SASI_Hs02_00530065 predicted 1518
6 SASI_Hs02_00530066 predicted 555
7 SASI_Hs02_00530067 predicted 1813
8 SASI_Hs02_00530068 predicted 947
9 SASI_Hs02_00530069 predicted 1503
10 SASI_Hs02_00530070 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530071 predicted 1672
2 SASI_Hs02_00530072 predicted 1816
3 SASI_Hs02_00530073 predicted 1614
4 SASI_Hs02_00530074 predicted 1855
5 SASI_Hs02_00530075 predicted 1514
6 SASI_Hs02_00530076 predicted 553
7 SASI_Hs02_00530077 predicted 1811
8 SASI_Hs02_00530078 predicted 947
9 SASI_Hs02_00530079 predicted 1510
10 SASI_Hs02_00530080 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530081 predicted 1675
2 SASI_Hs02_00530082 predicted 1809
3 SASI_Hs02_00530083 predicted 1620
4 SASI_Hs02_00530084 predicted 1861
5 SASI_Hs02_00530085 predicted 1518
6 SASI_Hs02_00530086 predicted 561
7 SASI_Hs02_00530087 predicted 1811
8 SASI_Hs02_00530088 predicted 947
9 SASI_Hs02_00530089 predicted 1502
10 SASI_Hs02_00530090 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145101
BTBD18 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1182s21c1
Sequence:CCGGGGCGGCAGAGGAGTGTAAATACTCGAGTATTTACACTCCTCTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145101.1-2746s21c1
Sequence:CCGGCATCCAGTCACTGGTAATTTACTCGAGTAAATTACCAGTGACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1076s21c1
Sequence:CCGGATCAGGCTCAGTCGCTCAAAGCTCGAGCTTTGAGCGACTGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-2213s21c1
Sequence:CCGGTTGACTACAGATGAGTTATTACTCGAGTAATAACTCATCTGTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1653s21c1
Sequence:CCGGAGGAACCTATGTTGGCTATTGCTCGAGCAATAGCCAACATAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145101
BTBD18 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1182s21c1
Sequence:CCGGGGCGGCAGAGGAGTGTAAATACTCGAGTATTTACACTCCTCTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145101.1-2746s21c1
Sequence:CCGGCATCCAGTCACTGGTAATTTACTCGAGTAAATTACCAGTGACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1076s21c1
Sequence:CCGGATCAGGCTCAGTCGCTCAAAGCTCGAGCTTTGAGCGACTGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-2213s21c1
Sequence:CCGGTTGACTACAGATGAGTTATTACTCGAGTAATAACTCATCTGTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1653s21c1
Sequence:CCGGAGGAACCTATGTTGGCTATTGCTCGAGCAATAGCCAACATAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145101
BTBD18 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1182s21c1
Sequence:CCGGGGCGGCAGAGGAGTGTAAATACTCGAGTATTTACACTCCTCTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145101.1-2746s21c1
Sequence:CCGGCATCCAGTCACTGGTAATTTACTCGAGTAAATTACCAGTGACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1076s21c1
Sequence:CCGGATCAGGCTCAGTCGCTCAAAGCTCGAGCTTTGAGCGACTGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-2213s21c1
Sequence:CCGGTTGACTACAGATGAGTTATTACTCGAGTAATAACTCATCTGTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145101.1-1653s21c1
Sequence:CCGGAGGAACCTATGTTGGCTATTGCTCGAGCAATAGCCAACATAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks