EMAIL THIS PAGE TO A FRIEND

BTBD19

BTB (POZ) domain containing 19

71 Gene Product Result for
UniProtKB ID: C9JJ37, B4E384, B7ZC36, B7ZC37
Gene ID:
Mouse(78611) BTB (POZ) domain containing 19
sheep(101110018) BTB (POZ) domain containing 19
domestic guinea pig(100723037) BTB (POZ) domain containing 19
naked mole-rat(101703153) BTB (POZ) domain containing 19
chicken(100858105) BTB (POZ) domain containing 19
cow(615438) BTB (POZ) domain containing 19
domestic cat(101088864) BTB (POZ) domain containing 19
dog(610643) BTB (POZ) domain containing 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725220 Rosetta Predictions human pricing
XM_001725874 Rosetta Predictions human pricing
XM_001726015 Rosetta Predictions human pricing
XM_927899 Rosetta Predictions human pricing
NM_001033187 Rosetta Predictions mouse pricing
NR_024078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466373 predicted 605
2 SASI_Hs02_00466374 predicted 588
3 SASI_Hs02_00466375 predicted 615
4 SASI_Hs02_00466376 predicted 1079
5 SASI_Hs02_00466377 predicted 412
6 SASI_Hs02_00466378 predicted 715
7 SASI_Hs02_00466379 predicted 428
8 SASI_Hs02_00466380 predicted 399
9 SASI_Hs02_00466381 predicted 1196
10 SASI_Hs02_00466382 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470547 predicted 601
2 SASI_Hs02_00470548 predicted 582
3 SASI_Hs02_00470549 predicted 607
4 SASI_Hs02_00470550 predicted 1085
5 SASI_Hs02_00470551 predicted 409
6 SASI_Hs02_00470552 predicted 715
7 SASI_Hs02_00470553 predicted 428
8 SASI_Hs02_00470554 predicted 403
9 SASI_Hs02_00470555 predicted 1191
10 SASI_Hs02_00470556 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471417 predicted 601
2 SASI_Hs02_00471418 predicted 580
3 SASI_Hs02_00471419 predicted 609
4 SASI_Hs02_00471420 predicted 1078
5 SASI_Hs02_00471421 predicted 413
6 SASI_Hs02_00471422 predicted 718
7 SASI_Hs02_00471423 predicted 428
8 SASI_Hs02_00471424 predicted 401
9 SASI_Hs02_00471425 predicted 1190
10 SASI_Hs02_00471426 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264735 predicted 277
2 SASI_Hs01_00264736 predicted 263
3 SASI_Hs01_00264737 predicted 250
4 SASI_Hs01_00264738 predicted 211
5 SASI_Hs01_00264739 predicted 273
6 SASI_Hs01_00264740 predicted 744
7 SASI_Hs01_00264741 predicted 383
8 SASI_Hs01_00264742 predicted 283
9 SASI_Hs01_00264743 predicted 856
10 SASI_Hs01_00264744 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161540 predicted 841
2 SASI_Mm01_00161541 predicted 604
3 SASI_Mm01_00161542 predicted 315
4 SASI_Mm01_00161543 predicted 546
5 SASI_Mm01_00161544 predicted 494
6 SASI_Mm01_00161545 predicted 862
7 SASI_Mm01_00161546 predicted 679
8 SASI_Mm01_00161547 predicted 561
9 SASI_Mm01_00161548 predicted 287
10 SASI_Mm01_00161549 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354528 predicted 1040
2 SASI_Mm02_00354529 predicted 1260
3 SASI_Mm02_00354530 predicted 630
4 SASI_Mm02_00354531 predicted 1683
5 SASI_Mm02_00354532 predicted 1914
6 SASI_Mm02_00354533 predicted 1445
7 SASI_Mm02_00354534 predicted 1879
8 SASI_Mm02_00354535 predicted 1772
9 SASI_Mm02_00354536 predicted 1097
10 SASI_Mm02_00354537 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136537
VALIDATED
BTBD19 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1088s21c1
Sequence:CCGGAGATTGTGGAGGCGTGGAAATCTCGAGATTTCCACGCCTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136537.1-1268s21c1
Sequence:CCGGCAAACTACAGCTCCCGAAGTGCTCGAGCACTTCGGGAGCTGTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-414s21c1
Sequence:CCGGCCCGCGATACAGTGATGTTTGCTCGAGCAAACATCACTGTATCGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-590s21c1
Sequence:CCGGCAGTGCTGGAGTTCCTATATACTCGAGTATATAGGAACTCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1193s21c1
Sequence:CCGGTTCTGGACCTGTCCTTCAAATCTCGAGATTTGAAGGACAGGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136537
VALIDATED
BTBD19 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1088s21c1
Sequence:CCGGAGATTGTGGAGGCGTGGAAATCTCGAGATTTCCACGCCTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136537.1-1268s21c1
Sequence:CCGGCAAACTACAGCTCCCGAAGTGCTCGAGCACTTCGGGAGCTGTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-414s21c1
Sequence:CCGGCCCGCGATACAGTGATGTTTGCTCGAGCAAACATCACTGTATCGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-590s21c1
Sequence:CCGGCAGTGCTGGAGTTCCTATATACTCGAGTATATAGGAACTCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1193s21c1
Sequence:CCGGTTCTGGACCTGTCCTTCAAATCTCGAGATTTGAAGGACAGGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136537
VALIDATED
BTBD19 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1088s21c1
Sequence:CCGGAGATTGTGGAGGCGTGGAAATCTCGAGATTTCCACGCCTCCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136537.1-1268s21c1
Sequence:CCGGCAAACTACAGCTCCCGAAGTGCTCGAGCACTTCGGGAGCTGTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-414s21c1
Sequence:CCGGCCCGCGATACAGTGATGTTTGCTCGAGCAAACATCACTGTATCGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136537.1-590s21c1
Sequence:CCGGCAGTGCTGGAGTTCCTATATACTCGAGTATATAGGAACTCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001136537.1-1193s21c1
Sequence:CCGGTTCTGGACCTGTCCTTCAAATCTCGAGATTTGAAGGACAGGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks