EMAIL THIS PAGE TO A FRIEND

BTBD1

BTB (POZ) domain containing 1

126 Gene Product Result for
Synonyms: C15orf1 NS5ATP8
UniProtKB ID: Q9H0C5, A6NMI8, Q9BX71, Q9NWN4
Gene ID:
Human(53339) Summary: The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(83962) BTB (POZ) domain containing 1
Rat(293060) BTB (POZ) domain containing 1
chicken(415461) BTB (POZ) domain containing 1
dog(479057) BTB (POZ) domain containing 1
domestic cat(101096896) BTB (POZ) domain containing 1
Horse(100068143) BTB (POZ) domain containing 1
cow(525916) BTB (POZ) domain containing 1
sheep(101106630) BTB (POZ) domain containing 1
domestic guinea pig(100724778) BTB (POZ) domain containing 1
naked mole-rat(101706036) BTB (POZ) domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011885 Rosetta Predictions human pricing
NM_025238 Rosetta Predictions human pricing
NM_001011932 Rosetta Predictions rat pricing
XM_001067480 Rosetta Predictions rat pricing
XM_574482 Rosetta Predictions rat pricing
NM_146193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109245 predicted 708
2 SASI_Hs01_00109246 predicted 1005
3 SASI_Hs01_00109252 predicted 1031
4 SASI_Hs01_00109253 predicted 824
5 SASI_Hs01_00109247 predicted 814
6 SASI_Hs01_00109248 predicted 743
7 SASI_Hs02_00306046 predicted 722
8 SASI_Hs01_00109249 predicted 845
9 SASI_Hs01_00109250 predicted 1307
10 SASI_Hs01_00109251 predicted 641
11 SASI_Hs01_00109254 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093544 predicted 892
2 SASI_Hs01_00093545 predicted 713
3 SASI_Hs01_00093546 predicted 717
4 SASI_Hs01_00093547 predicted 1014
5 SASI_Hs01_00093548 predicted 1028
6 SASI_Hs01_00093549 predicted 826
7 SASI_Hs01_00093550 predicted 813
8 SASI_Hs01_00093551 predicted 744
9 SASI_Hs01_00093552 predicted 743
10 SASI_Hs01_00093553 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033751 predicted 1558
2 SASI_Rn02_00199936 predicted 1256
3 SASI_Rn01_00033752 predicted 498
4 SASI_Rn01_00033753 predicted 1477
5 SASI_Rn01_00033755 predicted 648
6 SASI_Rn01_00033756 predicted 599
7 SASI_Rn01_00033757 predicted 1408
8 SASI_Rn01_00033759 predicted 543
9 SASI_Rn01_00033760 predicted 1318
10 SASI_Rn02_00199937 predicted 1133
11 SASI_Rn01_00033754 predicted 897
12 SASI_Rn01_00033758 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321140 predicted 1367
2 SASI_Rn02_00321141 predicted 1063
3 SASI_Rn02_00321142 predicted 303
4 SASI_Rn02_00321143 predicted 1284
5 SASI_Rn02_00321144 predicted 464
6 SASI_Rn02_00321145 predicted 408
7 SASI_Rn02_00321146 predicted 1222
8 SASI_Rn02_00321147 predicted 349
9 SASI_Rn02_00321148 predicted 1124
10 SASI_Rn02_00321149 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144714 predicted 1121
2 SASI_Rn01_00144715 predicted 368
3 SASI_Rn01_00144716 predicted 745
4 SASI_Rn01_00144717 predicted 760
5 SASI_Rn01_00144718 predicted 522
6 SASI_Rn01_00144719 predicted 462
7 SASI_Rn01_00144720 predicted 411
8 SASI_Rn01_00144721 predicted 552
9 SASI_Rn01_00144722 predicted 566
10 SASI_Rn01_00144723 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066715 predicted 1545
2 SASI_Mm02_00341889 predicted 1276
3 SASI_Mm01_00066716 predicted 565
4 SASI_Mm01_00066717 predicted 1171
5 SASI_Mm01_00066718 predicted 499
6 SASI_Mm01_00066719 predicted 1249
7 SASI_Mm01_00066720 predicted 869
8 SASI_Mm01_00066721 predicted 534
9 SASI_Mm01_00066722 predicted 590
10 SASI_Mm01_00066723 predicted 1439
11 SASI_Mm01_00066714 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017942
VALIDATED
BTBD1 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1347s1c1
Sequence:CCGGCAACACCCAAAGGTCCAGATTCTCGAGAATCTGGACCTTTGGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-503s1c1
Sequence:CCGGGAAACAGTTATGACCACTCTTCTCGAGAAGAGTGGTCATAACTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1455s1c1
Sequence:CCGGGCAATAATAATGGCACTTCAACTCGAGTTGAAGTGCCATTATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-626s1c1
Sequence:CCGGGCTCGATTATTTGATGAACCTCTCGAGAGGTTCATCAAATAATCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1047s1c1
Sequence:CCGGGAAAGGAATGCTGCATCAATACTCGAGTATTGATGCAGCATTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1128s1c1
Sequence:CCGGCAGTTAATAGAAGGATCTCTACTCGAGTAGAGATCCTTCTATTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1242s1c1
Sequence:CCGGGACAGAATGATACCGGCTTTACTCGAGTAAAGCCGGTATCATTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017942.1-704s1c1
Sequence:CCGGGCAGAAGGGTTCACTGATATTCTCGAGAATATCAGTGAACCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-930s1c1
Sequence:CCGGGTCCTGCTCAATCTGGAATTTCTCGAGAAATTCCAGATTGAGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-959s1c1
Sequence:CCGGCGTGAAGTGGTAAACCTCTTTCTCGAGAAAGAGGTTTACCACTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017942
VALIDATED
BTBD1 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1347s1c1
Sequence:CCGGCAACACCCAAAGGTCCAGATTCTCGAGAATCTGGACCTTTGGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-503s1c1
Sequence:CCGGGAAACAGTTATGACCACTCTTCTCGAGAAGAGTGGTCATAACTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1455s1c1
Sequence:CCGGGCAATAATAATGGCACTTCAACTCGAGTTGAAGTGCCATTATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-626s1c1
Sequence:CCGGGCTCGATTATTTGATGAACCTCTCGAGAGGTTCATCAAATAATCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1047s1c1
Sequence:CCGGGAAAGGAATGCTGCATCAATACTCGAGTATTGATGCAGCATTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1128s1c1
Sequence:CCGGCAGTTAATAGAAGGATCTCTACTCGAGTAGAGATCCTTCTATTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1242s1c1
Sequence:CCGGGACAGAATGATACCGGCTTTACTCGAGTAAAGCCGGTATCATTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017942.1-704s1c1
Sequence:CCGGGCAGAAGGGTTCACTGATATTCTCGAGAATATCAGTGAACCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-930s1c1
Sequence:CCGGGTCCTGCTCAATCTGGAATTTCTCGAGAAATTCCAGATTGAGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-959s1c1
Sequence:CCGGCGTGAAGTGGTAAACCTCTTTCTCGAGAAAGAGGTTTACCACTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017942
VALIDATED
BTBD1 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1347s1c1
Sequence:CCGGCAACACCCAAAGGTCCAGATTCTCGAGAATCTGGACCTTTGGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-503s1c1
Sequence:CCGGGAAACAGTTATGACCACTCTTCTCGAGAAGAGTGGTCATAACTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1455s1c1
Sequence:CCGGGCAATAATAATGGCACTTCAACTCGAGTTGAAGTGCCATTATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017942.1-626s1c1
Sequence:CCGGGCTCGATTATTTGATGAACCTCTCGAGAGGTTCATCAAATAATCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1047s1c1
Sequence:CCGGGAAAGGAATGCTGCATCAATACTCGAGTATTGATGCAGCATTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017942.1-1128s1c1
Sequence:CCGGCAGTTAATAGAAGGATCTCTACTCGAGTAGAGATCCTTCTATTAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-1242s1c1
Sequence:CCGGGACAGAATGATACCGGCTTTACTCGAGTAAAGCCGGTATCATTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017942.1-704s1c1
Sequence:CCGGGCAGAAGGGTTCACTGATATTCTCGAGAATATCAGTGAACCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-930s1c1
Sequence:CCGGGTCCTGCTCAATCTGGAATTTCTCGAGAAATTCCAGATTGAGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017942.1-959s1c1
Sequence:CCGGCGTGAAGTGGTAAACCTCTTTCTCGAGAAAGAGGTTTACCACTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146193
VALIDATED
BTBD1 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146193.1-2189s1c1
Sequence:CCGGGCTCTGGTACTATGATCTTATCTCGAGATAAGATCATAGTACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-654s1c1
Sequence:CCGGCCACGGATTATCAAGTGAATACTCGAGTATTCACTTGATAATCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-308s1c1
Sequence:CCGGGCTGTGACATTTGGAAACAAACTCGAGTTTGTTTCCAAATGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-362s1c1
Sequence:CCGGCGCTTCCCACTGATGACAATTCTCGAGAATTGTCATCAGTGGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-924s1c1
Sequence:CCGGGCAATAACAATGGCACATCAACTCGAGTTGATGTGCCATTGTTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-751s21c1
Sequence:CCGGCACACTGAGTATCCGAGAAAGCTCGAGCTTTCTCGGATACTCAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-702s21c1
Sequence:CCGGGGTTTACTGATATTGACATAGCTCGAGCTATGTCAATATCAGTAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1564s21c1
Sequence:CCGGTTTGAGTGTCTTGAGTATTTACTCGAGTAAATACTCAAGACACTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-497s21c1
Sequence:CCGGACCGTTATGACCACTCTTTATCTCGAGATAAAGAGTGGTCATAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1284s21c1
Sequence:CCGGTCATGTTCAAAGAACCTATAGCTCGAGCTATAGGTTCTTTGAACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1732s21c1
Sequence:CCGGTCGTGATCTTTCAGTAGTTTGCTCGAGCAAACTACTGAAAGATCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1148s21c1
Sequence:CCGGTTTGGTTTGTATGGATCTATTCTCGAGAATAGATCCATACAAACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146193
VALIDATED
BTBD1 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146193.1-2189s1c1
Sequence:CCGGGCTCTGGTACTATGATCTTATCTCGAGATAAGATCATAGTACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-654s1c1
Sequence:CCGGCCACGGATTATCAAGTGAATACTCGAGTATTCACTTGATAATCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-308s1c1
Sequence:CCGGGCTGTGACATTTGGAAACAAACTCGAGTTTGTTTCCAAATGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-362s1c1
Sequence:CCGGCGCTTCCCACTGATGACAATTCTCGAGAATTGTCATCAGTGGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-924s1c1
Sequence:CCGGGCAATAACAATGGCACATCAACTCGAGTTGATGTGCCATTGTTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-751s21c1
Sequence:CCGGCACACTGAGTATCCGAGAAAGCTCGAGCTTTCTCGGATACTCAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-702s21c1
Sequence:CCGGGGTTTACTGATATTGACATAGCTCGAGCTATGTCAATATCAGTAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1564s21c1
Sequence:CCGGTTTGAGTGTCTTGAGTATTTACTCGAGTAAATACTCAAGACACTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-497s21c1
Sequence:CCGGACCGTTATGACCACTCTTTATCTCGAGATAAAGAGTGGTCATAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1284s21c1
Sequence:CCGGTCATGTTCAAAGAACCTATAGCTCGAGCTATAGGTTCTTTGAACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1732s21c1
Sequence:CCGGTCGTGATCTTTCAGTAGTTTGCTCGAGCAAACTACTGAAAGATCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1148s21c1
Sequence:CCGGTTTGGTTTGTATGGATCTATTCTCGAGAATAGATCCATACAAACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146193
VALIDATED
BTBD1 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146193.1-2189s1c1
Sequence:CCGGGCTCTGGTACTATGATCTTATCTCGAGATAAGATCATAGTACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-654s1c1
Sequence:CCGGCCACGGATTATCAAGTGAATACTCGAGTATTCACTTGATAATCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-308s1c1
Sequence:CCGGGCTGTGACATTTGGAAACAAACTCGAGTTTGTTTCCAAATGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146193.1-362s1c1
Sequence:CCGGCGCTTCCCACTGATGACAATTCTCGAGAATTGTCATCAGTGGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146193.1-924s1c1
Sequence:CCGGGCAATAACAATGGCACATCAACTCGAGTTGATGTGCCATTGTTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-751s21c1
Sequence:CCGGCACACTGAGTATCCGAGAAAGCTCGAGCTTTCTCGGATACTCAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-702s21c1
Sequence:CCGGGGTTTACTGATATTGACATAGCTCGAGCTATGTCAATATCAGTAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1564s21c1
Sequence:CCGGTTTGAGTGTCTTGAGTATTTACTCGAGTAAATACTCAAGACACTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-497s21c1
Sequence:CCGGACCGTTATGACCACTCTTTATCTCGAGATAAAGAGTGGTCATAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1284s21c1
Sequence:CCGGTCATGTTCAAAGAACCTATAGCTCGAGCTATAGGTTCTTTGAACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146193.2-1732s21c1
Sequence:CCGGTCGTGATCTTTCAGTAGTTTGCTCGAGCAAACTACTGAAAGATCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146193.2-1148s21c1
Sequence:CCGGTTTGGTTTGTATGGATCTATTCTCGAGAATAGATCCATACAAACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)