EMAIL THIS PAGE TO A FRIEND

BTBD2

BTB (POZ) domain containing 2

71 Gene Product Result for
Gene ID:
Human(55643) Summary: The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Mouse(208198) BTB (POZ) domain containing 2
Rat(500793) BTB (POZ) domain containing 2
Zebrafish(565970) BTB (POZ) domain containing 2
chicken(420080) BTB (POZ) domain containing 2
cow(533435) BTB (POZ) domain containing 2
domestic cat(101100446) BTB (POZ) domain containing 2
dog(485074) BTB (POZ) domain containing 2
naked mole-rat(101719122) BTB (POZ) domain containing 2
domestic guinea pig(100712774) BTB (POZ) domain containing 2
sheep(101118022) BTB (POZ) domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303012 ANTI-BTBD2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2100229 Anti-BTBD2 antibody produced in rabbit affinity isolated antibody , human, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017797 Rosetta Predictions human pricing
XM_001076264 Rosetta Predictions rat pricing
XM_576181 Rosetta Predictions rat pricing
NM_145361 Rosetta Predictions mouse pricing
XM_001000710 Rosetta Predictions mouse pricing
XM_900785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240816 predicted 1195
2 SASI_Hs02_00350662 predicted 1337
3 SASI_Hs01_00240817 predicted 1283
4 SASI_Hs01_00240818 predicted 1427
5 SASI_Hs01_00240819 predicted 1162
6 SASI_Hs01_00240820 predicted 1257
7 SASI_Hs01_00240821 predicted 955
8 SASI_Hs01_00240822 predicted 1003
9 SASI_Hs01_00240824 predicted 745
10 SASI_Hs01_00240825 predicted 1300
11 SASI_Hs01_00240823 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352620 predicted 268
2 SASI_Rn02_00352621 predicted 811
3 SASI_Rn02_00352622 predicted 826
4 SASI_Rn02_00352623 predicted 212
5 SASI_Rn02_00352624 predicted 950
6 SASI_Rn02_00352625 predicted 992
7 SASI_Rn02_00352626 predicted 337
8 SASI_Rn02_00352627 predicted 1132
9 SASI_Rn02_00352628 predicted 1207
10 SASI_Rn02_00352629 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404796 predicted 294
2 SASI_Rn02_00404797 predicted 846
3 SASI_Rn02_00404798 predicted 856
4 SASI_Rn02_00404799 predicted 243
5 SASI_Rn02_00404800 predicted 980
6 SASI_Rn02_00404801 predicted 1016
7 SASI_Rn02_00404802 predicted 1157
8 SASI_Rn02_00404803 predicted 1235
9 SASI_Rn02_00404804 predicted 427
10 SASI_Rn02_00404805 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340621 predicted 1811
2 SASI_Mm02_00340622 predicted 1699
3 SASI_Mm02_00340623 predicted 1097
4 SASI_Mm02_00340624 predicted 1955
5 SASI_Mm02_00340625 predicted 996
6 SASI_Mm02_00340626 predicted 1774
7 SASI_Mm02_00340627 predicted 2015
8 SASI_Mm02_00340628 predicted 2405
9 SASI_Mm02_00340629 predicted 1874
10 SASI_Mm02_00340630 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280340 predicted 1816
2 SASI_Mm01_00280341 predicted 1705
3 SASI_Mm01_00280342 predicted 1099
4 SASI_Mm01_00280343 predicted 1963
5 SASI_Mm01_00280344 predicted 994
6 SASI_Mm01_00280345 predicted 1780
7 SASI_Mm01_00280346 predicted 2017
8 SASI_Mm01_00280347 predicted 2405
9 SASI_Mm01_00280348 predicted 1877
10 SASI_Mm01_00280349 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222736 predicted 860
2 SASI_Mm01_00222737 predicted 731
3 SASI_Mm01_00222738 predicted 729
4 SASI_Mm01_00222739 predicted 794
5 SASI_Mm01_00222740 predicted 1187
6 SASI_Mm01_00222741 predicted 796
7 SASI_Mm01_00222742 predicted 794
8 SASI_Mm01_00222743 predicted 850
9 SASI_Mm01_00222744 predicted 1298
10 SASI_Mm01_00222745 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017797
VALIDATED
BTBD2 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1182s21c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1255s21c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-516s21c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1557s21c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-627s1c1
Sequence:CCGGCGTGGAGTTCCTGAAGAAGAACTCGAGTTCTTCTTCAGGAACTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-516s1c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1255s1c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-432s1c1
Sequence:CCGGCGTCTTTGATGCCATGTTCAACTCGAGTTGAACATGGCATCAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-318s1c1
Sequence:CCGGCTTCGCCTTCCTCTTCAACAACTCGAGTTGTTGAAGAGGAAGGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1557s1c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1182s1c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1518s1c1
Sequence:CCGGGAACAACAATGGCACATCCGTCTCGAGACGGATGTGCCATTGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017797
VALIDATED
BTBD2 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1182s21c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1255s21c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-516s21c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1557s21c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-627s1c1
Sequence:CCGGCGTGGAGTTCCTGAAGAAGAACTCGAGTTCTTCTTCAGGAACTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-516s1c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1255s1c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-432s1c1
Sequence:CCGGCGTCTTTGATGCCATGTTCAACTCGAGTTGAACATGGCATCAAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-318s1c1
Sequence:CCGGCTTCGCCTTCCTCTTCAACAACTCGAGTTGTTGAAGAGGAAGGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1557s1c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1182s1c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1518s1c1
Sequence:CCGGGAACAACAATGGCACATCCGTCTCGAGACGGATGTGCCATTGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017797
VALIDATED
BTBD2 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1182s21c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1255s21c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-516s21c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017797.3-1557s21c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-627s1c1
Sequence:CCGGCGTGGAGTTCCTGAAGAAGAACTCGAGTTCTTCTTCAGGAACTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-516s1c1
Sequence:CCGGCGCACTGCTCAAGTTTCTCTACTCGAGTAGAGAAACTTGAGCAGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1255s1c1
Sequence:CCGGCAAGTGAACATCCAGATTATTCTCGAGAATAATCTGGATGTTCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-432s1c1
Sequence:CCGGCGTCTTTGATGCCATGTTCAACTCGAGTTGAACATGGCATCAAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-318s1c1
Sequence:CCGGCTTCGCCTTCCTCTTCAACAACTCGAGTTGTTGAAGAGGAAGGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1557s1c1
Sequence:CCGGCGAGGTCATCTTCTACACCTACTCGAGTAGGTGTAGAAGATGACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017797.2-1182s1c1
Sequence:CCGGGTTCTCAGTCAACAAGCGCATCTCGAGATGCGCTTGTTGACTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017797.2-1518s1c1
Sequence:CCGGGAACAACAATGGCACATCCGTCTCGAGACGGATGTGCCATTGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145361
BTBD2 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1561s21c1
Sequence:CCGGGGTCAGCCTCTTCCTACATTTCTCGAGAAATGTAGGAAGAGGCTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145361.2-2404s21c1
Sequence:CCGGCTTCAACTGCACACTGCAATGCTCGAGCATTGCAGTGTGCAGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1719s21c1
Sequence:CCGGTCTCGGTCAACAAGCGCATTTCTCGAGAAATGCGCTTGTTGACCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1751s21c1
Sequence:CCGGTTTGGGCTCTATGGATCTATTCTCGAGAATAGATCCATAGAGCCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1639s21c1
Sequence:CCGGGGGCAAGGAGTGTAGCATTAACTCGAGTTAATGCTACACTCCTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145361
BTBD2 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1561s21c1
Sequence:CCGGGGTCAGCCTCTTCCTACATTTCTCGAGAAATGTAGGAAGAGGCTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145361.2-2404s21c1
Sequence:CCGGCTTCAACTGCACACTGCAATGCTCGAGCATTGCAGTGTGCAGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1719s21c1
Sequence:CCGGTCTCGGTCAACAAGCGCATTTCTCGAGAAATGCGCTTGTTGACCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1751s21c1
Sequence:CCGGTTTGGGCTCTATGGATCTATTCTCGAGAATAGATCCATAGAGCCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1639s21c1
Sequence:CCGGGGGCAAGGAGTGTAGCATTAACTCGAGTTAATGCTACACTCCTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145361
BTBD2 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1561s21c1
Sequence:CCGGGGTCAGCCTCTTCCTACATTTCTCGAGAAATGTAGGAAGAGGCTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145361.2-2404s21c1
Sequence:CCGGCTTCAACTGCACACTGCAATGCTCGAGCATTGCAGTGTGCAGTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1719s21c1
Sequence:CCGGTCTCGGTCAACAAGCGCATTTCTCGAGAAATGCGCTTGTTGACCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1751s21c1
Sequence:CCGGTTTGGGCTCTATGGATCTATTCTCGAGAATAGATCCATAGAGCCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145361.2-1639s21c1
Sequence:CCGGGGGCAAGGAGTGTAGCATTAACTCGAGTTAATGCTACACTCCTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)