EMAIL THIS PAGE TO A FRIEND

BTBD3

BTB (POZ) domain containing 3

249 Gene Product Result for
Synonyms: dJ742J24.1
UniProtKB ID: Q9Y2F9, D3DW19, Q5JY73
Gene ID:
Mouse(228662) BTB (POZ) domain containing 3
Rat(311462) BTB (POZ) domain containing 3
sheep(101109555) BTB (POZ) domain containing 3
domestic guinea pig(100720645) BTB (POZ) domain containing 3
naked mole-rat(101701575) BTB (POZ) domain containing 3
chicken(427688) BTB (POZ) domain containing 3
domestic cat(101093677) BTB (POZ) domain containing 3
dog(477154) BTB (POZ) domain containing 3
cow(513420) BTB (POZ) domain containing 3
Horse(100063893) BTB (POZ) domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014962 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079911 MISSION® esiRNA esiRNA human BTBD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014962 Rosetta Predictions human pricing
NM_181443 Rosetta Predictions human pricing
NM_001107782 Rosetta Predictions rat pricing
NM_001025431 Rosetta Predictions mouse pricing
NM_145534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122578 predicted 1325
2 SASI_Hs01_00122579 predicted 1982
3 SASI_Hs01_00122581 predicted 1542
4 SASI_Hs01_00122582 predicted 1368
5 SASI_Hs01_00122583 predicted 1320
6 SASI_Hs02_00346653 predicted 1995
7 SASI_Hs01_00122584 predicted 1376
8 SASI_Hs01_00122586 predicted 831
9 SASI_Hs01_00122587 predicted 685
10 SASI_Hs02_00346654 predicted 1776
11 SASI_Hs01_00122580 predicted 1128
12 SASI_Hs01_00122585 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189118 predicted 1036
2 SASI_Hs01_00189119 predicted 1699
3 SASI_Hs01_00189121 predicted 1256
4 SASI_Hs01_00189122 predicted 1073
5 SASI_Hs01_00189123 predicted 1031
6 SASI_Hs02_00370056 predicted 1703
7 SASI_Hs01_00189124 predicted 1082
8 SASI_Hs01_00189126 predicted 539
9 SASI_Hs01_00189127 predicted 392
10 SASI_Hs02_00370057 predicted 1489
11 SASI_Hs01_00189120 predicted 831
12 SASI_Hs01_00189125 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232215 predicted 1419
2 SASI_Rn02_00232216 predicted 2023
3 SASI_Rn02_00232217 predicted 2052
4 SASI_Rn02_00232218 predicted 1413
5 SASI_Rn02_00232219 predicted 1593
6 SASI_Rn02_00232220 predicted 1724
7 SASI_Rn02_00232221 predicted 870
8 SASI_Rn02_00232222 predicted 1802
9 SASI_Rn02_00232223 predicted 1438
10 SASI_Rn02_00232224 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034426 predicted 1018
2 SASI_Mm01_00034427 predicted 605
3 SASI_Mm01_00034428 predicted 1148
4 SASI_Mm01_00034429 predicted 1171
5 SASI_Mm01_00034430 predicted 1543
6 SASI_Mm01_00034431 predicted 1524
7 SASI_Mm01_00034432 predicted 461
8 SASI_Mm01_00034434 predicted 911
9 SASI_Mm01_00034435 predicted 1319
10 SASI_Mm02_00287877 predicted 1555
11 SASI_Mm01_00034433 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085961 predicted 1314
2 SASI_Mm01_00085962 predicted 912
3 SASI_Mm01_00085963 predicted 1452
4 SASI_Mm01_00085964 predicted 1477
5 SASI_Mm01_00085965 predicted 1845
6 SASI_Mm01_00085966 predicted 1830
7 SASI_Mm01_00085967 predicted 756
8 SASI_Mm01_00085969 predicted 1209
9 SASI_Mm01_00085970 predicted 1622
10 SASI_Mm02_00341016 predicted 1860
11 SASI_Mm01_00085968 predicted 2099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025431
VALIDATED
BTBD3 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-4491s1c1
Sequence:CCGGCCGCATTATTTATGAAGGAAACTCGAGTTTCCTTCATAAATAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1445s1c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-398s1c1
Sequence:CCGGCCTCTGTAACAACAACCTCATCTCGAGATGAGGTTGTTGTTACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1266s1c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-659s1c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-2134s21c1
Sequence:CCGGTAAACCTCAGTGTACGAATTTCTCGAGAAATTCGTACACTGAGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025431.1-426s21c1
Sequence:CCGGCCCAACTGGCAGGGTCTTTATCTCGAGATAAAGACCCTGCCAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1266s21c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1445s21c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-659s21c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025431
VALIDATED
BTBD3 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-4491s1c1
Sequence:CCGGCCGCATTATTTATGAAGGAAACTCGAGTTTCCTTCATAAATAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1445s1c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-398s1c1
Sequence:CCGGCCTCTGTAACAACAACCTCATCTCGAGATGAGGTTGTTGTTACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1266s1c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-659s1c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-2134s21c1
Sequence:CCGGTAAACCTCAGTGTACGAATTTCTCGAGAAATTCGTACACTGAGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025431.1-426s21c1
Sequence:CCGGCCCAACTGGCAGGGTCTTTATCTCGAGATAAAGACCCTGCCAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1266s21c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1445s21c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-659s21c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025431
VALIDATED
BTBD3 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-4491s1c1
Sequence:CCGGCCGCATTATTTATGAAGGAAACTCGAGTTTCCTTCATAAATAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1445s1c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-398s1c1
Sequence:CCGGCCTCTGTAACAACAACCTCATCTCGAGATGAGGTTGTTGTTACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-1266s1c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025431.1-659s1c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-2134s21c1
Sequence:CCGGTAAACCTCAGTGTACGAATTTCTCGAGAAATTCGTACACTGAGGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025431.1-426s21c1
Sequence:CCGGCCCAACTGGCAGGGTCTTTATCTCGAGATAAAGACCCTGCCAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1266s21c1
Sequence:CCGGCGATTTCAGTCATGTGCCTATCTCGAGATAGGCACATGACTGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-1445s21c1
Sequence:CCGGCCAGAACTTGAGCAAGTACTTCTCGAGAAGTACTTGCTCAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025431.1-659s21c1
Sequence:CCGGCCTCGCCATGCTGAAATACATCTCGAGATGTATTTCAGCATGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014962
VALIDATED
BTBD3 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014962.2-3078s1c1
Sequence:CCGGGCCATCTTAAAGTGCCAACATCTCGAGATGTTGGCACTTTAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-4486s1c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1708s1c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1791s1c1
Sequence:CCGGCTCAGCTACTTTGGACAAGAACTCGAGTTCTTGTCCAAAGTAGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-1167s1c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1708s21c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1328s21c1
Sequence:CCGGCACAATGGCCCTCGATGATTTCTCGAGAAATCATCGAGGGCCATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014962.2-538s21c1
Sequence:CCGGAGAAGATGGCTGCTGATATATCTCGAGATATATCAGCAGCCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-4486s21c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1167s21c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014962
VALIDATED
BTBD3 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014962.2-3078s1c1
Sequence:CCGGGCCATCTTAAAGTGCCAACATCTCGAGATGTTGGCACTTTAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-4486s1c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1708s1c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1791s1c1
Sequence:CCGGCTCAGCTACTTTGGACAAGAACTCGAGTTCTTGTCCAAAGTAGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-1167s1c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1708s21c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1328s21c1
Sequence:CCGGCACAATGGCCCTCGATGATTTCTCGAGAAATCATCGAGGGCCATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014962.2-538s21c1
Sequence:CCGGAGAAGATGGCTGCTGATATATCTCGAGATATATCAGCAGCCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-4486s21c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1167s21c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014962
VALIDATED
BTBD3 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014962.2-3078s1c1
Sequence:CCGGGCCATCTTAAAGTGCCAACATCTCGAGATGTTGGCACTTTAAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-4486s1c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1708s1c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014962.2-1791s1c1
Sequence:CCGGCTCAGCTACTTTGGACAAGAACTCGAGTTCTTGTCCAAAGTAGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014962.2-1167s1c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1708s21c1
Sequence:CCGGCCTTTCCCGTATGGTTTGAATCTCGAGATTCAAACCATACGGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1328s21c1
Sequence:CCGGCACAATGGCCCTCGATGATTTCTCGAGAAATCATCGAGGGCCATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014962.2-538s21c1
Sequence:CCGGAGAAGATGGCTGCTGATATATCTCGAGATATATCAGCAGCCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-4486s21c1
Sequence:CCGGGCAGTCTTTGTCGTTGTTCATCTCGAGATGAACAACGACAAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014962.2-1167s21c1
Sequence:CCGGGAAAGTATTCTCCGTAGGGAACTCGAGTTCCCTACGGAGAATACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)