EMAIL THIS PAGE TO A FRIEND

BTBD6

BTB (POZ) domain containing 6

47 Gene Product Result for
Synonyms: BDPL
UniProtKB ID: Q96KE9, Q8IVQ7, Q9BR94
Gene ID:
Mouse(399566) BTB (POZ) domain containing 6
Rat(690367) BTB (POZ) domain containing 6
chicken(101669127) BTB (POZ) domain containing 6
cow(100125777) BTB (POZ) domain containing 6
chicken(101752037) BTB (POZ) domain containing 6
dog(611389) BTB (POZ) domain containing 6
naked mole-rat(101724477) BTB (POZ) domain containing 6
domestic guinea pig(100716222) BTB (POZ) domain containing 6
sheep(101106971) BTB (POZ) domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39756 Anti-BTBD6 antibody produced in rabbit IgG fraction of antiserum human, zebrafish, horse, rabbit, bovine, guinea pig
immunohistochemistry, western blot pricing
HPA031355 Anti-BTBD6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103175 Anti-BTBD6 antibody produced in rabbit affinity isolated antibody zebrafish, bovine, rat, rabbit, canine, mouse, guinea pig, horse, human
western blot pricing
SAB2104640 Anti-BTBD6 antibody produced in rabbit affinity isolated antibody , zebrafish, guinea pig, horse, rabbit, human, bovine, rat, mouse
western blot pricing
SAB4503529 Anti-BTBD6 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033271 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159271 MISSION® esiRNA esiRNA human BTBD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033271 Rosetta Predictions human pricing
NM_001077683 Rosetta Predictions rat pricing
NM_201646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221952 predicted 493
2 SASI_Hs01_00221955 predicted 1219
3 SASI_Hs01_00221956 predicted 1614
4 SASI_Hs01_00221958 predicted 400
5 SASI_Hs01_00221959 predicted 1605
6 SASI_Hs01_00221960 predicted 1100
7 SASI_Hs01_00221961 predicted 1299
8 SASI_Hs01_00221953 predicted 513
9 SASI_Hs01_00221954 predicted 550
10 SASI_Hs01_00221957 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207949 predicted 1288
2 SASI_Rn02_00207950 predicted 1072
3 SASI_Rn02_00207951 predicted 1412
4 SASI_Rn02_00207952 predicted 1037
5 SASI_Rn02_00207953 predicted 646
6 SASI_Rn02_00207954 predicted 543
7 SASI_Rn02_00207955 predicted 1096
8 SASI_Rn02_00207956 predicted 978
9 SASI_Rn02_00207957 predicted 499
10 SASI_Rn02_00207958 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172625 predicted 728
2 SASI_Mm01_00172626 predicted 1070
3 SASI_Mm01_00172627 predicted 1122
4 SASI_Mm01_00172628 predicted 1352
5 SASI_Mm01_00172629 predicted 1284
6 SASI_Mm01_00172630 predicted 1052
7 SASI_Mm01_00172631 predicted 1006
8 SASI_Mm01_00172632 predicted 789
9 SASI_Mm01_00172633 predicted 1238
10 SASI_Mm01_00172634 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201646
BTBD6 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201646.2-565s21c1
Sequence:CCGGTGCGGAAGTGAAGTCAGAAATCTCGAGATTTCTGACTTCACTTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201646.1-1973s1c1
Sequence:CCGGCCTCCCATTCAAGCCACAAATCTCGAGATTTGTGGCTTGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-729s1c1
Sequence:CCGGGCGTCAACTTTCTGGAAACAACTCGAGTTGTTTCCAGAAAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1413s1c1
Sequence:CCGGCCAAGTTTGTTTCAGACGGATCTCGAGATCCGTCTGAAACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-626s1c1
Sequence:CCGGCTAAAGTACATGTACAGCGATCTCGAGATCGCTGTACATGTACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1010s1c1
Sequence:CCGGCCTCACAACAAGAGGCATGTTCTCGAGAACATGCCTCTTGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201646
BTBD6 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201646.2-565s21c1
Sequence:CCGGTGCGGAAGTGAAGTCAGAAATCTCGAGATTTCTGACTTCACTTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201646.1-1973s1c1
Sequence:CCGGCCTCCCATTCAAGCCACAAATCTCGAGATTTGTGGCTTGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-729s1c1
Sequence:CCGGGCGTCAACTTTCTGGAAACAACTCGAGTTGTTTCCAGAAAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1413s1c1
Sequence:CCGGCCAAGTTTGTTTCAGACGGATCTCGAGATCCGTCTGAAACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-626s1c1
Sequence:CCGGCTAAAGTACATGTACAGCGATCTCGAGATCGCTGTACATGTACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1010s1c1
Sequence:CCGGCCTCACAACAAGAGGCATGTTCTCGAGAACATGCCTCTTGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201646
BTBD6 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201646.2-565s21c1
Sequence:CCGGTGCGGAAGTGAAGTCAGAAATCTCGAGATTTCTGACTTCACTTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201646.1-1973s1c1
Sequence:CCGGCCTCCCATTCAAGCCACAAATCTCGAGATTTGTGGCTTGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-729s1c1
Sequence:CCGGGCGTCAACTTTCTGGAAACAACTCGAGTTGTTTCCAGAAAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1413s1c1
Sequence:CCGGCCAAGTTTGTTTCAGACGGATCTCGAGATCCGTCTGAAACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-626s1c1
Sequence:CCGGCTAAAGTACATGTACAGCGATCTCGAGATCGCTGTACATGTACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201646.1-1010s1c1
Sequence:CCGGCCTCACAACAAGAGGCATGTTCTCGAGAACATGCCTCTTGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033271
BTBD6 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033271.2-1638s21c1
Sequence:CCGGACCATGAAAGGCTGCTCTTAACTCGAGTTAAGAGCAGCCTTTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1421s21c1
Sequence:CCGGGCAGCGAACTCAGCTACTTTGCTCGAGCAAAGTAGCTGAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1535s21c1
Sequence:CCGGGGCAGATCCCTGAGCTCATTTCTCGAGAAATGAGCTCAGGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-439s1c1
Sequence:CCGGGCGGAAGTCAAATCTGAAATTCTCGAGAATTTCAGATTTGACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1225s1c1
Sequence:CCGGGCTGAGTACAGCGTGAAGATTCTCGAGAATCTTCACGCTGTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1344s1c1
Sequence:CCGGCCAGGTTGAACAAGACACCTTCTCGAGAAGGTGTCTTGTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-913s1c1
Sequence:CCGGGCCCTCTATCTGGTCCGAATTCTCGAGAATTCGGACCAGATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-408s1c1
Sequence:CCGGCGTCTTCTATGCCATGTTCTACTCGAGTAGAACATGGCATAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033271
BTBD6 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033271.2-1638s21c1
Sequence:CCGGACCATGAAAGGCTGCTCTTAACTCGAGTTAAGAGCAGCCTTTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1421s21c1
Sequence:CCGGGCAGCGAACTCAGCTACTTTGCTCGAGCAAAGTAGCTGAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1535s21c1
Sequence:CCGGGGCAGATCCCTGAGCTCATTTCTCGAGAAATGAGCTCAGGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-439s1c1
Sequence:CCGGGCGGAAGTCAAATCTGAAATTCTCGAGAATTTCAGATTTGACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1225s1c1
Sequence:CCGGGCTGAGTACAGCGTGAAGATTCTCGAGAATCTTCACGCTGTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1344s1c1
Sequence:CCGGCCAGGTTGAACAAGACACCTTCTCGAGAAGGTGTCTTGTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-913s1c1
Sequence:CCGGGCCCTCTATCTGGTCCGAATTCTCGAGAATTCGGACCAGATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-408s1c1
Sequence:CCGGCGTCTTCTATGCCATGTTCTACTCGAGTAGAACATGGCATAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033271
BTBD6 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033271.2-1638s21c1
Sequence:CCGGACCATGAAAGGCTGCTCTTAACTCGAGTTAAGAGCAGCCTTTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1421s21c1
Sequence:CCGGGCAGCGAACTCAGCTACTTTGCTCGAGCAAAGTAGCTGAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033271.2-1535s21c1
Sequence:CCGGGGCAGATCCCTGAGCTCATTTCTCGAGAAATGAGCTCAGGGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-439s1c1
Sequence:CCGGGCGGAAGTCAAATCTGAAATTCTCGAGAATTTCAGATTTGACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1225s1c1
Sequence:CCGGGCTGAGTACAGCGTGAAGATTCTCGAGAATCTTCACGCTGTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-1344s1c1
Sequence:CCGGCCAGGTTGAACAAGACACCTTCTCGAGAAGGTGTCTTGTTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-913s1c1
Sequence:CCGGGCCCTCTATCTGGTCCGAATTCTCGAGAATTCGGACCAGATAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033271.1-408s1c1
Sequence:CCGGCGTCTTCTATGCCATGTTCTACTCGAGTAGAACATGGCATAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks