EMAIL THIS PAGE TO A FRIEND

BTBD7

BTB (POZ) domain containing 7

Synonyms: FUP1
Gene ID:
Mouse(238386) BTB (POZ) domain containing 7
Rat(362772) BTB (POZ) domain containing 7
Zebrafish(568372) BTB (POZ) domain containing 7
chicken(423424) BTB (POZ) domain containing 7
dog(490834) BTB (POZ) domain containing 7
domestic cat(101099976) BTB (POZ) domain containing 7
Horse(100053454) BTB (POZ) domain containing 7
cow(100300409) BTB (POZ) domain containing 7
sheep(101115910) BTB (POZ) domain containing 7
Domestic Rabbit(100347844) BTB (POZ) domain containing 7
domestic guinea pig(100716596) BTB (POZ) domain containing 7
naked mole-rat(101702948) BTB (POZ) domain containing 7
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002860 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002860 Rosetta Predictions human pricing
NM_018167 Rosetta Predictions human pricing
NM_001108720 Rosetta Predictions rat pricing
NM_172806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154061 predicted 885
2 SASI_Hs01_00154062 predicted 727
3 SASI_Hs01_00154063 predicted 718
4 SASI_Hs01_00154065 predicted 736
5 SASI_Hs01_00154066 predicted 872
6 SASI_Hs02_00304231 predicted 977
7 SASI_Hs01_00154067 predicted 884
8 SASI_Hs01_00154068 predicted 872
9 SASI_Hs02_00304232 predicted 1091
10 SASI_Hs01_00154070 predicted 1221
11 SASI_Hs01_00154064 predicted 743
12 SASI_Hs01_00154069 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120756 predicted 881
2 SASI_Hs01_00120757 predicted 725
3 SASI_Hs01_00120758 predicted 718
4 SASI_Hs01_00120760 predicted 736
5 SASI_Hs01_00120761 predicted 879
6 SASI_Hs02_00351418 predicted 975
7 SASI_Hs01_00120762 predicted 883
8 SASI_Hs01_00120763 predicted 877
9 SASI_Hs02_00351419 predicted 1093
10 SASI_Hs01_00120765 predicted 1215
11 SASI_Hs01_00120759 predicted 743
12 SASI_Hs01_00120764 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241415 predicted 2661
2 SASI_Rn02_00241416 predicted 791
3 SASI_Rn02_00241417 predicted 1012
4 SASI_Rn02_00241418 predicted 1475
5 SASI_Rn02_00241419 predicted 1469
6 SASI_Rn02_00241420 predicted 2433
7 SASI_Rn02_00241421 predicted 2161
8 SASI_Rn02_00241422 predicted 1994
9 SASI_Rn02_00241423 predicted 1086
10 SASI_Rn02_00241424 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195415 predicted 2021
2 SASI_Mm02_00344729 predicted 870
3 SASI_Mm01_00195416 predicted 2499
4 SASI_Mm01_00195417 predicted 3249
5 SASI_Mm01_00195418 predicted 1825
6 SASI_Mm01_00195419 predicted 1805
7 SASI_Mm01_00195420 predicted 1686
8 SASI_Mm01_00195421 predicted 2134
9 SASI_Mm01_00195422 predicted 1561
10 SASI_Mm02_00344730 predicted 991
11 SASI_Mm01_00195423 predicted 2528
12 SASI_Mm01_00195424 predicted 3894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172806
VALIDATED
BTBD7 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-849s1c1
Sequence:CCGGCGACCTTTATGAGGATAAGTACTCGAGTACTTATCCTCATAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1161s1c1
Sequence:CCGGGCGTGGACTCTTTGATTACATCTCGAGATGTAATCAAAGAGTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172806.2-4162s1c1
Sequence:CCGGGCTACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172806.2-1391s21c1
Sequence:CCGGTATTAGATGAGTCCATTATACCTCGAGGTATAATGGACTCATCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-3901s21c1
Sequence:CCGGACAACTTACTGACCGGTTTATCTCGAGATAAACCGGTCAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-2016s21c1
Sequence:CCGGTGAACACATCCTACCTATAAACTCGAGTTTATAGGTAGGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1638s1c1
Sequence:CCGGCATCTCATTAGACACCTTAATCTCGAGATTAAGGTGTCTAATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1566s21c1
Sequence:CCGGACTTTACCACATAGCACTATTCTCGAGAATAGTGCTATGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1272s21c1
Sequence:CCGGCAAAGCCCACAAGGCTATTATCTCGAGATAATAGCCTTGTGGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172806
VALIDATED
BTBD7 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-849s1c1
Sequence:CCGGCGACCTTTATGAGGATAAGTACTCGAGTACTTATCCTCATAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1161s1c1
Sequence:CCGGGCGTGGACTCTTTGATTACATCTCGAGATGTAATCAAAGAGTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172806.2-4162s1c1
Sequence:CCGGGCTACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172806.2-1391s21c1
Sequence:CCGGTATTAGATGAGTCCATTATACCTCGAGGTATAATGGACTCATCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-3901s21c1
Sequence:CCGGACAACTTACTGACCGGTTTATCTCGAGATAAACCGGTCAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-2016s21c1
Sequence:CCGGTGAACACATCCTACCTATAAACTCGAGTTTATAGGTAGGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1638s1c1
Sequence:CCGGCATCTCATTAGACACCTTAATCTCGAGATTAAGGTGTCTAATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1566s21c1
Sequence:CCGGACTTTACCACATAGCACTATTCTCGAGAATAGTGCTATGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1272s21c1
Sequence:CCGGCAAAGCCCACAAGGCTATTATCTCGAGATAATAGCCTTGTGGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172806
VALIDATED
BTBD7 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-849s1c1
Sequence:CCGGCGACCTTTATGAGGATAAGTACTCGAGTACTTATCCTCATAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1161s1c1
Sequence:CCGGGCGTGGACTCTTTGATTACATCTCGAGATGTAATCAAAGAGTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172806.2-4162s1c1
Sequence:CCGGGCTACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172806.2-1391s21c1
Sequence:CCGGTATTAGATGAGTCCATTATACCTCGAGGTATAATGGACTCATCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-3901s21c1
Sequence:CCGGACAACTTACTGACCGGTTTATCTCGAGATAAACCGGTCAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-2016s21c1
Sequence:CCGGTGAACACATCCTACCTATAAACTCGAGTTTATAGGTAGGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172806.2-1638s1c1
Sequence:CCGGCATCTCATTAGACACCTTAATCTCGAGATTAAGGTGTCTAATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1566s21c1
Sequence:CCGGACTTTACCACATAGCACTATTCTCGAGAATAGTGCTATGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172806.2-1272s21c1
Sequence:CCGGCAAAGCCCACAAGGCTATTATCTCGAGATAATAGCCTTGTGGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002860
VALIDATED
BTBD7 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 7
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3196s1c1
Sequence:CCGGCCCTGCACATTCTGGTCATAACTCGAGTTATGACCAGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-616s1c1
Sequence:CCGGGTGCGAATTGAACACATCTTACTCGAGTAAGATGTGTTCAATTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2809s1c1
Sequence:CCGGGCCACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1183s1c1
Sequence:CCGGCCTCACAAATTCTTTCCTGATCTCGAGATCAGGAAAGAATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3583s1c1
Sequence:CCGGGCAGTGGAAATAGAGAAGTAACTCGAGTTACTTCTCTATTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2234s1c1
Sequence:CCGGCAGTAGAAACTGACTTGACTTCTCGAGAAGTCAAGTCAGTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-1886s1c1
Sequence:CCGGCGGATTTCTATGACTTCTCAACTCGAGTTGAGAAGTCATAGAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002860.1-1368s1c1
Sequence:CCGGCCCAATCCATAACCAACTCAACTCGAGTTGAGTTGGTTATGGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-858s1c1
Sequence:CCGGGCGAATGGTTAGAATGTCCAACTCGAGTTGGACATTCTAACCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1796s1c1
Sequence:CCGGCGTGTATTCCACAGAGACATACTCGAGTATGTCTCTGTGGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-2071s1c1
Sequence:CCGGGCTAGGAGAGAATATCCACTTCTCGAGAAGTGGATATTCTCTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-852s1c1
Sequence:CCGGGCGCTTGCGAATGGTTAGAATCTCGAGATTCTAACCATTCGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-2685s21c1
Sequence:CCGGCAGCACCCTTCACGTTCATTTCTCGAGAAATGAACGTGAAGGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-747s21c1
Sequence:CCGGTGTACTGATGTAGACTTAATACTCGAGTATTAAGTCTACATCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1892s21c1
Sequence:CCGGTGAACACATCTTACCTATAAACTCGAGTTTATAGGTAAGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1514s21c1
Sequence:CCGGCATCTCATTAGATACCTTAATCTCGAGATTAAGGTATCTAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-2156s21c1
Sequence:CCGGCACGCTCTACATGGTCAATAACTCGAGTTATTGACCATGTAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3224s21c1
Sequence:CCGGCCCTTCGCAAGGTGGATATTTCTCGAGAAATATCCACCTTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3821s21c1
Sequence:CCGGTAACTCGGTTTCACATGATTTCTCGAGAAATCATGTGAAACCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002860
VALIDATED
BTBD7 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 7
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3196s1c1
Sequence:CCGGCCCTGCACATTCTGGTCATAACTCGAGTTATGACCAGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-616s1c1
Sequence:CCGGGTGCGAATTGAACACATCTTACTCGAGTAAGATGTGTTCAATTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2809s1c1
Sequence:CCGGGCCACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1183s1c1
Sequence:CCGGCCTCACAAATTCTTTCCTGATCTCGAGATCAGGAAAGAATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3583s1c1
Sequence:CCGGGCAGTGGAAATAGAGAAGTAACTCGAGTTACTTCTCTATTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2234s1c1
Sequence:CCGGCAGTAGAAACTGACTTGACTTCTCGAGAAGTCAAGTCAGTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-1886s1c1
Sequence:CCGGCGGATTTCTATGACTTCTCAACTCGAGTTGAGAAGTCATAGAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002860.1-1368s1c1
Sequence:CCGGCCCAATCCATAACCAACTCAACTCGAGTTGAGTTGGTTATGGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-858s1c1
Sequence:CCGGGCGAATGGTTAGAATGTCCAACTCGAGTTGGACATTCTAACCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1796s1c1
Sequence:CCGGCGTGTATTCCACAGAGACATACTCGAGTATGTCTCTGTGGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-2071s1c1
Sequence:CCGGGCTAGGAGAGAATATCCACTTCTCGAGAAGTGGATATTCTCTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-852s1c1
Sequence:CCGGGCGCTTGCGAATGGTTAGAATCTCGAGATTCTAACCATTCGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-2685s21c1
Sequence:CCGGCAGCACCCTTCACGTTCATTTCTCGAGAAATGAACGTGAAGGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-747s21c1
Sequence:CCGGTGTACTGATGTAGACTTAATACTCGAGTATTAAGTCTACATCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1892s21c1
Sequence:CCGGTGAACACATCTTACCTATAAACTCGAGTTTATAGGTAAGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1514s21c1
Sequence:CCGGCATCTCATTAGATACCTTAATCTCGAGATTAAGGTATCTAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-2156s21c1
Sequence:CCGGCACGCTCTACATGGTCAATAACTCGAGTTATTGACCATGTAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3224s21c1
Sequence:CCGGCCCTTCGCAAGGTGGATATTTCTCGAGAAATATCCACCTTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3821s21c1
Sequence:CCGGTAACTCGGTTTCACATGATTTCTCGAGAAATCATGTGAAACCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002860
VALIDATED
BTBD7 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 7
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3196s1c1
Sequence:CCGGCCCTGCACATTCTGGTCATAACTCGAGTTATGACCAGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-616s1c1
Sequence:CCGGGTGCGAATTGAACACATCTTACTCGAGTAAGATGTGTTCAATTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2809s1c1
Sequence:CCGGGCCACATTTAAAGGACTGTATCTCGAGATACAGTCCTTTAAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1183s1c1
Sequence:CCGGCCTCACAAATTCTTTCCTGATCTCGAGATCAGGAAAGAATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002860.1-3583s1c1
Sequence:CCGGGCAGTGGAAATAGAGAAGTAACTCGAGTTACTTCTCTATTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-2234s1c1
Sequence:CCGGCAGTAGAAACTGACTTGACTTCTCGAGAAGTCAAGTCAGTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-1886s1c1
Sequence:CCGGCGGATTTCTATGACTTCTCAACTCGAGTTGAGAAGTCATAGAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002860.1-1368s1c1
Sequence:CCGGCCCAATCCATAACCAACTCAACTCGAGTTGAGTTGGTTATGGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002860.1-858s1c1
Sequence:CCGGGCGAATGGTTAGAATGTCCAACTCGAGTTGGACATTCTAACCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-1796s1c1
Sequence:CCGGCGTGTATTCCACAGAGACATACTCGAGTATGTCTCTGTGGAATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002860.1-2071s1c1
Sequence:CCGGGCTAGGAGAGAATATCCACTTCTCGAGAAGTGGATATTCTCTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002860.1-852s1c1
Sequence:CCGGGCGCTTGCGAATGGTTAGAATCTCGAGATTCTAACCATTCGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-2685s21c1
Sequence:CCGGCAGCACCCTTCACGTTCATTTCTCGAGAAATGAACGTGAAGGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-747s21c1
Sequence:CCGGTGTACTGATGTAGACTTAATACTCGAGTATTAAGTCTACATCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1892s21c1
Sequence:CCGGTGAACACATCTTACCTATAAACTCGAGTTTATAGGTAAGATGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002860.2-1514s21c1
Sequence:CCGGCATCTCATTAGATACCTTAATCTCGAGATTAAGGTATCTAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-2156s21c1
Sequence:CCGGCACGCTCTACATGGTCAATAACTCGAGTTATTGACCATGTAGAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3224s21c1
Sequence:CCGGCCCTTCGCAAGGTGGATATTTCTCGAGAAATATCCACCTTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001002860.2-3821s21c1
Sequence:CCGGTAACTCGGTTTCACATGATTTCTCGAGAAATCATGTGAAACCGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks