EMAIL THIS PAGE TO A FRIEND

BTBD9

BTB (POZ) domain containing 9

82 Gene Product Result for
Synonyms: dJ322I12.1
UniProtKB ID: Q96Q07, Q494V9, Q494W1, Q96M00
Gene ID:
Human(114781) Summary: This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
Mouse(224671) BTB (POZ) domain containing 9
Rat(294318) BTB (POZ) domain containing 9
sheep(101101928) BTB (POZ) domain containing 9
Domestic Rabbit(100345172) BTB (POZ) domain containing 9
domestic guinea pig(100721629) BTB (POZ) domain containing 9
naked mole-rat(101700528) BTB (POZ) domain containing 9
Zebrafish(557659) BTB (POZ) domain containing 9
cow(505504) BTB (POZ) domain containing 9
Horse(100065100) BTB (POZ) domain containing 9
domestic cat(101084540) BTB (POZ) domain containing 9
dog(481777) BTB (POZ) domain containing 9
chicken(421429) BTB (POZ) domain containing 9
fruit fly(32000) BTB (POZ) domain containing 9 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099272 Rosetta Predictions human pricing
NM_052893 Rosetta Predictions human pricing
NM_152733 Rosetta Predictions human pricing
NM_001013073 Rosetta Predictions rat pricing
NM_027060 Rosetta Predictions mouse pricing
NM_172618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320317 predicted 2003
2 SASI_Hs02_00320318 predicted 1910
3 SASI_Hs02_00320319 predicted 1158
4 SASI_Hs02_00320320 predicted 1778
5 SASI_Hs02_00320321 predicted 1453
6 SASI_Hs02_00320322 predicted 792
7 SASI_Hs02_00320323 predicted 1470
8 SASI_Hs02_00320324 predicted 1977
9 SASI_Hs02_00320325 predicted 1843
10 SASI_Hs02_00320326 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361620 predicted 2200
2 SASI_Hs02_00361621 predicted 2119
3 SASI_Hs02_00361622 predicted 1355
4 SASI_Hs02_00361623 predicted 1983
5 SASI_Hs02_00361624 predicted 1652
6 SASI_Hs02_00361625 predicted 989
7 SASI_Hs02_00361626 predicted 1675
8 SASI_Hs02_00361627 predicted 2178
9 SASI_Hs02_00361628 predicted 2047
10 SASI_Hs02_00361629 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185944 predicted 1739
2 SASI_Hs02_00366650 predicted 1655
3 SASI_Hs01_00185945 predicted 893
4 SASI_Hs01_00185946 predicted 1518
5 SASI_Hs02_00366651 predicted 1190
6 SASI_Hs01_00185947 predicted 527
7 SASI_Hs01_00185949 predicted 1209
8 SASI_Hs01_00185950 predicted 1720
9 SASI_Hs01_00185951 predicted 1589
10 SASI_Hs01_00185952 predicted 1600
11 SASI_Hs01_00185943 predicted 496
12 SASI_Hs01_00185948 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080429 predicted 717
2 SASI_Rn01_00080430 predicted 491
3 SASI_Rn01_00080431 predicted 325
4 SASI_Rn01_00080432 predicted 1185
5 SASI_Rn02_00200704 predicted 1314
6 SASI_Rn01_00080433 predicted 657
7 SASI_Rn01_00080434 predicted 485
8 SASI_Rn02_00200705 predicted 1503
9 SASI_Rn01_00080436 predicted 913
10 SASI_Rn01_00080437 predicted 856
11 SASI_Rn01_00080435 predicted 1645
12 SASI_Rn01_00080438 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331471 predicted 1645
2 SASI_Mm02_00331472 predicted 1795
3 SASI_Mm02_00331473 predicted 1712
4 SASI_Mm02_00331474 predicted 387
5 SASI_Mm02_00331475 predicted 1797
6 SASI_Mm02_00331476 predicted 548
7 SASI_Mm02_00331477 predicted 1378
8 SASI_Mm02_00331478 predicted 1229
9 SASI_Mm02_00331479 predicted 599
10 SASI_Mm02_00331480 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135936 predicted 1640
2 SASI_Mm01_00135937 predicted 1792
3 SASI_Mm01_00135938 predicted 1711
4 SASI_Mm01_00135939 predicted 395
5 SASI_Mm01_00135940 predicted 1792
6 SASI_Mm01_00135941 predicted 550
7 SASI_Mm01_00135942 predicted 1382
8 SASI_Mm01_00135943 predicted 1236
9 SASI_Mm01_00135944 predicted 594
10 SASI_Mm01_00135945 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152733
VALIDATED
BTBD9 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-366s1c1
Sequence:CCGGGCAGAAGCATTCACAATGCTACTCGAGTAGCATTGTGAATGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-458s1c1
Sequence:CCGGCCTGGCTCATAAATATGGATTCTCGAGAATCCATATTTATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-372s1c1
Sequence:CCGGGCATTCACAATGCTACTCAAACTCGAGTTTGAGTAGCATTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1581s1c1
Sequence:CCGGGATTGTGATGATCGAAGCTATCTCGAGATAGCTTCGATCATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-459s1c1
Sequence:CCGGCTGGCTCATAAATATGGATTTCTCGAGAAATCCATATTTATGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-1545s1c1
Sequence:CCGGCCGTACATGATTGGGTCAATACTCGAGTATTGACCCAATCATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-991s1c1
Sequence:CCGGCAGCCTTATTAGATGGTGATACTCGAGTATCACCATCTAATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1098s1c1
Sequence:CCGGCCATCCGTTATCAATCACATACTCGAGTATGTGATTGATAACGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1933s21c1
Sequence:CCGGCCAACCGGCAGCACCAATAAACTCGAGTTTATTGGTGCTGCCGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-895s21c1
Sequence:CCGGGGGATATGGACCTCAATTATACTCGAGTATAATTGAGGTCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1254s21c1
Sequence:CCGGGCCCGTGTCTGCAGGTATATTCTCGAGAATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152733
VALIDATED
BTBD9 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-366s1c1
Sequence:CCGGGCAGAAGCATTCACAATGCTACTCGAGTAGCATTGTGAATGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-458s1c1
Sequence:CCGGCCTGGCTCATAAATATGGATTCTCGAGAATCCATATTTATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-372s1c1
Sequence:CCGGGCATTCACAATGCTACTCAAACTCGAGTTTGAGTAGCATTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1581s1c1
Sequence:CCGGGATTGTGATGATCGAAGCTATCTCGAGATAGCTTCGATCATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-459s1c1
Sequence:CCGGCTGGCTCATAAATATGGATTTCTCGAGAAATCCATATTTATGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-1545s1c1
Sequence:CCGGCCGTACATGATTGGGTCAATACTCGAGTATTGACCCAATCATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-991s1c1
Sequence:CCGGCAGCCTTATTAGATGGTGATACTCGAGTATCACCATCTAATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1098s1c1
Sequence:CCGGCCATCCGTTATCAATCACATACTCGAGTATGTGATTGATAACGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1933s21c1
Sequence:CCGGCCAACCGGCAGCACCAATAAACTCGAGTTTATTGGTGCTGCCGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-895s21c1
Sequence:CCGGGGGATATGGACCTCAATTATACTCGAGTATAATTGAGGTCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1254s21c1
Sequence:CCGGGCCCGTGTCTGCAGGTATATTCTCGAGAATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152733
VALIDATED
BTBD9 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-366s1c1
Sequence:CCGGGCAGAAGCATTCACAATGCTACTCGAGTAGCATTGTGAATGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-458s1c1
Sequence:CCGGCCTGGCTCATAAATATGGATTCTCGAGAATCCATATTTATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152733.1-372s1c1
Sequence:CCGGGCATTCACAATGCTACTCAAACTCGAGTTTGAGTAGCATTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1581s1c1
Sequence:CCGGGATTGTGATGATCGAAGCTATCTCGAGATAGCTTCGATCATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-459s1c1
Sequence:CCGGCTGGCTCATAAATATGGATTTCTCGAGAAATCCATATTTATGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-1545s1c1
Sequence:CCGGCCGTACATGATTGGGTCAATACTCGAGTATTGACCCAATCATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152733.1-991s1c1
Sequence:CCGGCAGCCTTATTAGATGGTGATACTCGAGTATCACCATCTAATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152733.1-1098s1c1
Sequence:CCGGCCATCCGTTATCAATCACATACTCGAGTATGTGATTGATAACGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1933s21c1
Sequence:CCGGCCAACCGGCAGCACCAATAAACTCGAGTTTATTGGTGCTGCCGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-895s21c1
Sequence:CCGGGGGATATGGACCTCAATTATACTCGAGTATAATTGAGGTCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152733.2-1254s21c1
Sequence:CCGGGCCCGTGTCTGCAGGTATATTCTCGAGAATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172618
BTBD9 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1526s1c1
Sequence:CCGGCGATGATCGAAGCTACAGCTACTCGAGTAGCTGTAGCTTCGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-606s1c1
Sequence:CCGGGCACTCCTGAATATCGTCTTACTCGAGTAAGACGATATTCAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1226s1c1
Sequence:CCGGGACTCACAACACAGTGAACAACTCGAGTTGTTCACTGTGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.2-433s1c1
Sequence:CCGGCACGATGCTCCTCAGATATATCTCGAGATATATCTGAGGAGCATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172618.2-5711s21c1
Sequence:CCGGACTTGCCATGTGGAGTATTTACTCGAGTAAATACTCCACATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1145s21c1
Sequence:CCGGCTTGGCCAGCCGTCCATTATACTCGAGTATAATGGACGGCTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1309s21c1
Sequence:CCGGAGCCCGTGTCTGCAGGTATATCTCGAGATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1191s21c1
Sequence:CCGGACCGTGACAGCCGGTCTTATTCTCGAGAATAAGACCGGCTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-723s21c1
Sequence:CCGGCACTCCTGAATATCGTCTTAACTCGAGTTAAGACGATATTCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172618
BTBD9 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1526s1c1
Sequence:CCGGCGATGATCGAAGCTACAGCTACTCGAGTAGCTGTAGCTTCGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-606s1c1
Sequence:CCGGGCACTCCTGAATATCGTCTTACTCGAGTAAGACGATATTCAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1226s1c1
Sequence:CCGGGACTCACAACACAGTGAACAACTCGAGTTGTTCACTGTGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.2-433s1c1
Sequence:CCGGCACGATGCTCCTCAGATATATCTCGAGATATATCTGAGGAGCATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172618.2-5711s21c1
Sequence:CCGGACTTGCCATGTGGAGTATTTACTCGAGTAAATACTCCACATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1145s21c1
Sequence:CCGGCTTGGCCAGCCGTCCATTATACTCGAGTATAATGGACGGCTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1309s21c1
Sequence:CCGGAGCCCGTGTCTGCAGGTATATCTCGAGATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1191s21c1
Sequence:CCGGACCGTGACAGCCGGTCTTATTCTCGAGAATAAGACCGGCTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-723s21c1
Sequence:CCGGCACTCCTGAATATCGTCTTAACTCGAGTTAAGACGATATTCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172618
BTBD9 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1526s1c1
Sequence:CCGGCGATGATCGAAGCTACAGCTACTCGAGTAGCTGTAGCTTCGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-606s1c1
Sequence:CCGGGCACTCCTGAATATCGTCTTACTCGAGTAAGACGATATTCAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.1-1226s1c1
Sequence:CCGGGACTCACAACACAGTGAACAACTCGAGTTGTTCACTGTGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172618.2-433s1c1
Sequence:CCGGCACGATGCTCCTCAGATATATCTCGAGATATATCTGAGGAGCATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172618.2-5711s21c1
Sequence:CCGGACTTGCCATGTGGAGTATTTACTCGAGTAAATACTCCACATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1145s21c1
Sequence:CCGGCTTGGCCAGCCGTCCATTATACTCGAGTATAATGGACGGCTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1309s21c1
Sequence:CCGGAGCCCGTGTCTGCAGGTATATCTCGAGATATACCTGCAGACACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-1191s21c1
Sequence:CCGGACCGTGACAGCCGGTCTTATTCTCGAGAATAAGACCGGCTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172618.2-723s21c1
Sequence:CCGGCACTCCTGAATATCGTCTTAACTCGAGTTAAGACGATATTCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks