EMAIL THIS PAGE TO A FRIEND

BTC

betacellulin

UniProtKB ID: P35070, Q96F48
Gene ID:
Human(685) Summary: The protein encoded by this gene is a member of the EGF family of growth factors. It is synthesized primarily as a transmembrane precursor, which is then processed to mature molecule by proteolytic events. This protein is a ligand for the EGF receptor. [provided by RefSeq, Jul 2008]
Mouse(12223) betacellulin, epidermal growth factor family member
Rat(64022) betacellulin
Zebrafish(503869) betacellulin, epidermal growth factor family member
chicken(448833) betacellulin
dog(482682) betacellulin
Horse(100056845) betacellulin
cow(280737) betacellulin
sheep(101103979) betacellulin
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001729 Rosetta Predictions human pricing
NM_022256 Rosetta Predictions rat pricing
NM_007568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219906 predicted 446
2 SASI_Hs01_00219907 predicted 393
3 SASI_Hs01_00219908 predicted 506
4 SASI_Hs01_00219909 predicted 446
5 SASI_Hs01_00219910 predicted 397
6 SASI_Hs01_00219911 predicted 499
7 SASI_Hs01_00219912 predicted 448
8 SASI_Hs01_00219913 predicted 517
9 SASI_Hs01_00219914 predicted 428
10 SASI_Hs01_00219915 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095107 predicted 291
2 SASI_Rn01_00095108 predicted 287
3 SASI_Rn01_00095109 predicted 311
4 SASI_Rn01_00095110 predicted 355
5 SASI_Rn01_00095111 predicted 284
6 SASI_Rn01_00095112 predicted 318
7 SASI_Rn01_00095113 predicted 287
8 SASI_Rn01_00095114 predicted 276
9 SASI_Rn01_00095115 predicted 282
10 SASI_Rn01_00095116 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311942 predicted 294
2 SASI_Mm02_00311943 predicted 305
3 SASI_Mm02_00311944 predicted 456
4 SASI_Mm02_00311945 predicted 694
5 SASI_Mm02_00311946 predicted 977
6 SASI_Mm02_00311947 predicted 858
7 SASI_Mm02_00311948 predicted 431
8 SASI_Mm02_00311949 predicted 434
9 SASI_Mm02_00311950 predicted 718
10 SASI_Mm02_00311951 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001729
BTC MISSION shRNA Bacterial Glycerol Stock
betacellulin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-510s21c1
Sequence:CCGGGCTACCACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001729.2-1105s21c1
Sequence:CCGGGCAACAACAGAAGGGAAATTTCTCGAGAAATTTCCCTTCTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-844s21c1
Sequence:CCGGCTCCTATCAATGAAGATATTGCTCGAGCAATATCTTCATTGATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001729.1-1101s1c1
Sequence:CCGGCCAGGATTACTAGTCAAACAACTCGAGTTGTTTGACTAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-398s1c1
Sequence:CCGGCCACCAGAAGTCCTGAAACTACTCGAGTAGTTTCAGGACTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-352s1c1
Sequence:CCGGGCCCTGGGTCTAGTGATCCTTCTCGAGAAGGATCACTAGACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-507s1c1
Sequence:CCGGGCAATACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-724s1c1
Sequence:CCGGCCTCTTCGGAAACGTCGTAAACTCGAGTTTACGACGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001729
BTC MISSION shRNA shRNA Plasmid DNA
betacellulin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-510s21c1
Sequence:CCGGGCTACCACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001729.2-1105s21c1
Sequence:CCGGGCAACAACAGAAGGGAAATTTCTCGAGAAATTTCCCTTCTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-844s21c1
Sequence:CCGGCTCCTATCAATGAAGATATTGCTCGAGCAATATCTTCATTGATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001729.1-1101s1c1
Sequence:CCGGCCAGGATTACTAGTCAAACAACTCGAGTTGTTTGACTAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-398s1c1
Sequence:CCGGCCACCAGAAGTCCTGAAACTACTCGAGTAGTTTCAGGACTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-352s1c1
Sequence:CCGGGCCCTGGGTCTAGTGATCCTTCTCGAGAAGGATCACTAGACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-507s1c1
Sequence:CCGGGCAATACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-724s1c1
Sequence:CCGGCCTCTTCGGAAACGTCGTAAACTCGAGTTTACGACGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001729
BTC MISSION shRNA Lentiviral Transduction Particles
betacellulin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-510s21c1
Sequence:CCGGGCTACCACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001729.2-1105s21c1
Sequence:CCGGGCAACAACAGAAGGGAAATTTCTCGAGAAATTTCCCTTCTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001729.2-844s21c1
Sequence:CCGGCTCCTATCAATGAAGATATTGCTCGAGCAATATCTTCATTGATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001729.1-1101s1c1
Sequence:CCGGCCAGGATTACTAGTCAAACAACTCGAGTTGTTTGACTAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-398s1c1
Sequence:CCGGCCACCAGAAGTCCTGAAACTACTCGAGTAGTTTCAGGACTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-352s1c1
Sequence:CCGGGCCCTGGGTCTAGTGATCCTTCTCGAGAAGGATCACTAGACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-507s1c1
Sequence:CCGGGCAATACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001729.1-724s1c1
Sequence:CCGGCCTCTTCGGAAACGTCGTAAACTCGAGTTTACGACGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007568
VALIDATED
BTC MISSION shRNA Bacterial Glycerol Stock
betacellulin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-278s21c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007568.4-1252s21c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-622s21c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-688s21c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-1253s1c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-406s1c1
Sequence:CCGGGCAGTACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-279s1c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-623s1c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-689s1c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007568
VALIDATED
BTC MISSION shRNA shRNA Plasmid DNA
betacellulin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-278s21c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007568.4-1252s21c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-622s21c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-688s21c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-1253s1c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-406s1c1
Sequence:CCGGGCAGTACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-279s1c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-623s1c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-689s1c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007568
VALIDATED
BTC MISSION shRNA Lentiviral Transduction Particles
betacellulin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-278s21c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007568.4-1252s21c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-622s21c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007568.4-688s21c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-1253s1c1
Sequence:CCGGCCGGGTTTATACACTTATCATCTCGAGATGATAAGTGTATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-406s1c1
Sequence:CCGGGCAGTACAAGCATTACTGCATCTCGAGATGCAGTAATGCTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-279s1c1
Sequence:CCGGTGGTAGCAGATGGGAACACAACTCGAGTTGTGTTCCCATCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-623s1c1
Sequence:CCGGCCTCTTCGGAAACATCGTAAACTCGAGTTTACGATGTTTCCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007568.2-689s1c1
Sequence:CCGGCCCATAAGTGAAGATATTCAACTCGAGTTGAATATCTTCACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks