EMAIL THIS PAGE TO A FRIEND

BTD

biotinidase

66 Gene Product Result for
UniProtKB ID: P43251, B2R865, Q96EM9
Gene ID:
Human(686) Summary: Biotinidase functions to recycle biotin in the body by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. Biotinidase has also been shown to have biotinyl-transferase activity. Defects in the biotinidase gene cause multiple carboxylase deficiency. [provided by RefSeq, Jul 2008]
Mouse(26363) biotinidase
Rat(306262) biotinidase
sheep(101113196) biotinidase
Zebrafish(555376) biotinidase
fruit fly(31912) buttonhead
cow(537669) biotinidase
Horse(100063800) biotinidase
dog(477059) biotinidase
chicken(420639) biotinidase
fruit fly(31552) Biotinidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000060 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000060 Rosetta Predictions human pricing
NM_001012047 Rosetta Predictions rat pricing
XM_577477 Rosetta Predictions rat pricing
NM_025295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029449 predicted 1644
2 SASI_Hs02_00301776 predicted 848
3 SASI_Hs01_00029450 predicted 617
4 SASI_Hs01_00029451 predicted 1714
5 SASI_Hs01_00029452 predicted 915
6 SASI_Hs01_00029453 predicted 1446
7 SASI_Hs01_00029454 predicted 1367
8 SASI_Hs01_00029455 predicted 591
9 SASI_Hs01_00029456 predicted 1763
10 SASI_Hs01_00029457 predicted 440
11 SASI_Hs01_00029448 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047583 predicted 1072
2 SASI_Rn01_00047584 predicted 1509
3 SASI_Rn01_00047585 predicted 1646
4 SASI_Rn01_00047586 predicted 1637
5 SASI_Rn01_00047587 predicted 375
6 SASI_Rn02_00200149 predicted 808
7 SASI_Rn01_00047589 predicted 626
8 SASI_Rn02_00200150 predicted 669
9 SASI_Rn02_00200151 predicted 1301
10 SASI_Rn01_00047591 predicted 1091
11 SASI_Rn01_00047588 predicted 388
12 SASI_Rn01_00047590 predicted 407
13 SASI_Rn01_00047592 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163499 predicted 2116
2 SASI_Rn01_00163500 predicted 1618
3 SASI_Rn01_00163501 predicted 1460
4 SASI_Rn01_00163502 predicted 1953
5 SASI_Rn01_00163503 predicted 1548
6 SASI_Rn01_00163504 predicted 1509
7 SASI_Rn01_00163505 predicted 1808
8 SASI_Rn01_00163506 predicted 1557
9 SASI_Rn01_00163507 predicted 2042
10 SASI_Rn01_00163508 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065371 predicted 601
2 SASI_Mm01_00065373 predicted 1008
3 SASI_Mm01_00065374 predicted 383
4 SASI_Mm02_00327909 predicted 1488
5 SASI_Mm01_00065375 predicted 794
6 SASI_Mm01_00065376 predicted 743
7 SASI_Mm01_00065377 predicted 1616
8 SASI_Mm01_00065378 predicted 825
9 SASI_Mm02_00327910 predicted 358
10 SASI_Mm01_00065379 predicted 589
11 SASI_Mm01_00065372 predicted 1203
12 SASI_Mm01_00065380 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025295
VALIDATED
BTD MISSION shRNA Bacterial Glycerol Stock
biotinidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-1491s1c1
Sequence:CCGGGCACTTTGTATATCTTTCCTTCTCGAGAAGGAAAGATATACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-490s1c1
Sequence:CCGGCCTGAGTTGTATGGCCATCAACTCGAGTTGATGGCCATACAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025295.1-334s1c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025295.1-650s1c1
Sequence:CCGGCGTAAGCACAACCTGTACTTTCTCGAGAAAGTACAGGTTGTGCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-747s21c1
Sequence:CCGGCACTTGCTTTGACATCCTATTCTCGAGAATAGGATGTCAAAGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-608s21c1
Sequence:CCGGATGTGGTGTTCAGCGACAATGCTCGAGCATTGTCGCTGAACACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-333s21c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-359s21c1
Sequence:CCGGGTATCCACGGATTCAACTTTACTCGAGTAAAGTTGAATCCGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-581s21c1
Sequence:CCGGAGGACGGGAGATACCAGTTTACTCGAGTAAACTGGTATCTCCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-1717s21c1
Sequence:CCGGTGCTGGGAAAGCCACCCTTGTCTCGAGACAAGGGTGGCTTTCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025295
VALIDATED
BTD MISSION shRNA shRNA Plasmid DNA
biotinidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-1491s1c1
Sequence:CCGGGCACTTTGTATATCTTTCCTTCTCGAGAAGGAAAGATATACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-490s1c1
Sequence:CCGGCCTGAGTTGTATGGCCATCAACTCGAGTTGATGGCCATACAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025295.1-334s1c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025295.1-650s1c1
Sequence:CCGGCGTAAGCACAACCTGTACTTTCTCGAGAAAGTACAGGTTGTGCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-747s21c1
Sequence:CCGGCACTTGCTTTGACATCCTATTCTCGAGAATAGGATGTCAAAGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-608s21c1
Sequence:CCGGATGTGGTGTTCAGCGACAATGCTCGAGCATTGTCGCTGAACACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-333s21c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-359s21c1
Sequence:CCGGGTATCCACGGATTCAACTTTACTCGAGTAAAGTTGAATCCGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-581s21c1
Sequence:CCGGAGGACGGGAGATACCAGTTTACTCGAGTAAACTGGTATCTCCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-1717s21c1
Sequence:CCGGTGCTGGGAAAGCCACCCTTGTCTCGAGACAAGGGTGGCTTTCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025295
VALIDATED
BTD MISSION shRNA Lentiviral Transduction Particles
biotinidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-1491s1c1
Sequence:CCGGGCACTTTGTATATCTTTCCTTCTCGAGAAGGAAAGATATACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025295.1-490s1c1
Sequence:CCGGCCTGAGTTGTATGGCCATCAACTCGAGTTGATGGCCATACAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025295.1-334s1c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025295.1-650s1c1
Sequence:CCGGCGTAAGCACAACCTGTACTTTCTCGAGAAAGTACAGGTTGTGCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-747s21c1
Sequence:CCGGCACTTGCTTTGACATCCTATTCTCGAGAATAGGATGTCAAAGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-608s21c1
Sequence:CCGGATGTGGTGTTCAGCGACAATGCTCGAGCATTGTCGCTGAACACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-333s21c1
Sequence:CCGGGCAGATTATAGTGTTCCCAGACTCGAGTCTGGGAACACTATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-359s21c1
Sequence:CCGGGTATCCACGGATTCAACTTTACTCGAGTAAAGTTGAATCCGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025295.3-581s21c1
Sequence:CCGGAGGACGGGAGATACCAGTTTACTCGAGTAAACTGGTATCTCCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025295.3-1717s21c1
Sequence:CCGGTGCTGGGAAAGCCACCCTTGTCTCGAGACAAGGGTGGCTTTCCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000060
VALIDATED
BTD MISSION shRNA Bacterial Glycerol Stock
biotinidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-873s1c1
Sequence:CCGGGCAGCAATTGAGATTCAGAAACTCGAGTTTCTGAATCTCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1298s1c1
Sequence:CCGGCCTCTGCTGTTATTTACTTTACTCGAGTAAAGTAAATAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-105s1c1
Sequence:CCGGGCCAGAAGTAAGCTTGCTCTTCTCGAGAAGAGCAAGCTTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-677s1c1
Sequence:CCGGCCTCTACTTTGAGGCAGCATTCTCGAGAATGCTGCCTCAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1573s1c1
Sequence:CCGGGCTGGGAGAATGACCACTATTCTCGAGAATAGTGGTCATTCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-444s21c1
Sequence:CCGGGCATTCATGGATTCAACTTTACTCGAGTAAAGTTGAATCCATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-719s21c1
Sequence:CCGGCTTGTTGACCGCTACCGTAAACTCGAGTTTACGGTAGCGGTCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000060.2-1163s21c1
Sequence:CCGGACGGACCCATCCCATAGTAAGCTCGAGCTTACTATGGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000060
VALIDATED
BTD MISSION shRNA shRNA Plasmid DNA
biotinidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-873s1c1
Sequence:CCGGGCAGCAATTGAGATTCAGAAACTCGAGTTTCTGAATCTCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1298s1c1
Sequence:CCGGCCTCTGCTGTTATTTACTTTACTCGAGTAAAGTAAATAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-105s1c1
Sequence:CCGGGCCAGAAGTAAGCTTGCTCTTCTCGAGAAGAGCAAGCTTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-677s1c1
Sequence:CCGGCCTCTACTTTGAGGCAGCATTCTCGAGAATGCTGCCTCAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1573s1c1
Sequence:CCGGGCTGGGAGAATGACCACTATTCTCGAGAATAGTGGTCATTCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-444s21c1
Sequence:CCGGGCATTCATGGATTCAACTTTACTCGAGTAAAGTTGAATCCATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-719s21c1
Sequence:CCGGCTTGTTGACCGCTACCGTAAACTCGAGTTTACGGTAGCGGTCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000060.2-1163s21c1
Sequence:CCGGACGGACCCATCCCATAGTAAGCTCGAGCTTACTATGGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000060
VALIDATED
BTD MISSION shRNA Lentiviral Transduction Particles
biotinidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-873s1c1
Sequence:CCGGGCAGCAATTGAGATTCAGAAACTCGAGTTTCTGAATCTCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1298s1c1
Sequence:CCGGCCTCTGCTGTTATTTACTTTACTCGAGTAAAGTAAATAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000060.1-105s1c1
Sequence:CCGGGCCAGAAGTAAGCTTGCTCTTCTCGAGAAGAGCAAGCTTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-677s1c1
Sequence:CCGGCCTCTACTTTGAGGCAGCATTCTCGAGAATGCTGCCTCAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000060.1-1573s1c1
Sequence:CCGGGCTGGGAGAATGACCACTATTCTCGAGAATAGTGGTCATTCTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-444s21c1
Sequence:CCGGGCATTCATGGATTCAACTTTACTCGAGTAAAGTTGAATCCATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000060.2-719s21c1
Sequence:CCGGCTTGTTGACCGCTACCGTAAACTCGAGTTTACGGTAGCGGTCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000060.2-1163s21c1
Sequence:CCGGACGGACCCATCCCATAGTAAGCTCGAGCTTACTATGGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks