EMAIL THIS PAGE TO A FRIEND

BTF3

basic transcription factor 3

63 Gene Product Result for
Synonyms: BETA-NAC BTF3a BTF3b NACB
UniProtKB ID: P20290, A8K510, Q13893, Q76M56
Gene ID:
Human(689) Summary: This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(218490) basic transcription factor 3
Rat(294680) basic transcription factor 3
Zebrafish(556625) basic transcription factor 3
chicken(426154) basic transcription factor 3
domestic cat(101093239) basic transcription factor 3
dog(608628) basic transcription factor 3
cow(281031) basic transcription factor 3
Thale Cress(838367) basic transcription factor 3
domestic guinea pig(100732991) basic transcription factor 3
naked mole-rat(101712768) basic transcription factor 3
sheep(101113885) basic transcription factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001207 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037637 Rosetta Predictions human pricing
NM_001207 Rosetta Predictions human pricing
NM_001008309 Rosetta Predictions rat pricing
NM_145455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124566 predicted 711
2 SASI_Hs02_00308337 predicted 803
3 SASI_Hs01_00124567 predicted 812
4 SASI_Hs01_00124568 predicted 576
5 SASI_Hs01_00124570 predicted 362
6 SASI_Hs01_00124569 predicted 675
7 SASI_Hs01_00124571 predicted 532
8 SASI_Hs01_00124572 predicted 523
9 SASI_Hs01_00124573 predicted 498
10 SASI_Hs01_00124574 predicted 499
11 SASI_Hs01_00124575 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028809 predicted 466
2 SASI_Hs02_00331352 predicted 561
3 SASI_Hs01_00028810 predicted 571
4 SASI_Hs01_00028811 predicted 327
5 SASI_Hs01_00028812 predicted 427
6 SASI_Hs01_00028813 predicted 292
7 SASI_Hs01_00028814 predicted 287
8 SASI_Hs01_00028815 predicted 263
9 SASI_Hs01_00028816 predicted 265
10 SASI_Hs01_00028817 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038619 predicted 613
2 SASI_Rn01_00038620 predicted 582
3 SASI_Rn02_00199030 predicted 427
4 SASI_Rn02_00199031 predicted 359
5 SASI_Rn02_00199032 predicted 194
6 SASI_Rn01_00038621 predicted 626
7 SASI_Rn02_00199033 predicted 393
8 SASI_Rn02_00199034 predicted 472
9 SASI_Rn02_00199035 predicted 504
10 SASI_Rn02_00199036 predicted 262
11 SASI_Rn01_00038622 predicted 766
12 SASI_Rn01_00038623 predicted 804
13 SASI_Rn01_00038624 predicted 818
14 SASI_Rn01_00038625 predicted 804
15 SASI_Rn01_00038626 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124151 predicted 295
2 SASI_Mm01_00124153 predicted 391
3 SASI_Mm01_00124154 predicted 629
4 SASI_Mm01_00124149 predicted 436
5 SASI_Mm01_00124156 predicted 536
6 SASI_Mm01_00124157 predicted 673
7 SASI_Mm01_00124158 predicted 406
8 SASI_Mm02_00340843 predicted 516
9 SASI_Mm02_00340844 predicted 412
10 SASI_Mm02_00340845 predicted 608
11 SASI_Mm01_00124150 predicted 338
12 SASI_Mm01_00124152 predicted 339
13 SASI_Mm01_00124155 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145455
VALIDATED
BTF3 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-469s21c1
Sequence:CCGGGAAACTGCAGTTCTCCTTAAACTCGAGTTTAAGGAGAACTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-854s21c1
Sequence:CCGGGGTGATACTTGCAGAAATTACCTCGAGGTAATTTCTGCAAGTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-519s21c1
Sequence:CCGGTTGAAGAGGTGAACATGTTTACTCGAGTAAACATGTTCACCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-330s21c1
Sequence:CCGGGACGGGAGTCTCAGATGAAAGCTCGAGCTTTCATCTGAGACTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-781s21c1
Sequence:CCGGTCCAGATCTGGTGGAGAATTTCTCGAGAAATTCTCCACCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145455.2-839s1c1
Sequence:CCGGGCAACTTCTGAAGAAGGTGATCTCGAGATCACCTTCTTCAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-353s1c1
Sequence:CCGGACAATCATGAACCAGGAGAAACTCGAGTTTCTCCTGGTTCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-332s1c1
Sequence:CCGGCGGGAGTCTCAGATGAAAGAACTCGAGTTCTTTCATCTGAGACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-593s1c1
Sequence:CCGGGCAGCAAACACCTTCACCATTCTCGAGAATGGTGAAGGTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-422s1c1
Sequence:CCGGCGTAGGAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145455
VALIDATED
BTF3 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-469s21c1
Sequence:CCGGGAAACTGCAGTTCTCCTTAAACTCGAGTTTAAGGAGAACTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-854s21c1
Sequence:CCGGGGTGATACTTGCAGAAATTACCTCGAGGTAATTTCTGCAAGTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-519s21c1
Sequence:CCGGTTGAAGAGGTGAACATGTTTACTCGAGTAAACATGTTCACCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-330s21c1
Sequence:CCGGGACGGGAGTCTCAGATGAAAGCTCGAGCTTTCATCTGAGACTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-781s21c1
Sequence:CCGGTCCAGATCTGGTGGAGAATTTCTCGAGAAATTCTCCACCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145455.2-839s1c1
Sequence:CCGGGCAACTTCTGAAGAAGGTGATCTCGAGATCACCTTCTTCAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-353s1c1
Sequence:CCGGACAATCATGAACCAGGAGAAACTCGAGTTTCTCCTGGTTCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-332s1c1
Sequence:CCGGCGGGAGTCTCAGATGAAAGAACTCGAGTTCTTTCATCTGAGACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-593s1c1
Sequence:CCGGGCAGCAAACACCTTCACCATTCTCGAGAATGGTGAAGGTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-422s1c1
Sequence:CCGGCGTAGGAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145455
VALIDATED
BTF3 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-469s21c1
Sequence:CCGGGAAACTGCAGTTCTCCTTAAACTCGAGTTTAAGGAGAACTGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-854s21c1
Sequence:CCGGGGTGATACTTGCAGAAATTACCTCGAGGTAATTTCTGCAAGTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-519s21c1
Sequence:CCGGTTGAAGAGGTGAACATGTTTACTCGAGTAAACATGTTCACCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145455.2-330s21c1
Sequence:CCGGGACGGGAGTCTCAGATGAAAGCTCGAGCTTTCATCTGAGACTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145455.2-781s21c1
Sequence:CCGGTCCAGATCTGGTGGAGAATTTCTCGAGAAATTCTCCACCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145455.2-839s1c1
Sequence:CCGGGCAACTTCTGAAGAAGGTGATCTCGAGATCACCTTCTTCAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-353s1c1
Sequence:CCGGACAATCATGAACCAGGAGAAACTCGAGTTTCTCCTGGTTCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-332s1c1
Sequence:CCGGCGGGAGTCTCAGATGAAAGAACTCGAGTTCTTTCATCTGAGACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-593s1c1
Sequence:CCGGGCAGCAAACACCTTCACCATTCTCGAGAATGGTGAAGGTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145455.2-422s1c1
Sequence:CCGGCGTAGGAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001207
VALIDATED
BTF3 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-384s21c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-419s21c1
Sequence:CCGGGACAAAGCAGCTGACAGAAATCTCGAGATTTCTGTCAGCTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-444s21c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-800s21c1
Sequence:CCGGTTCATTCTTTGCAGCTAATTACTCGAGTAATTAGCTGCAAAGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-338s21c1
Sequence:CCGGAGGAACAGTGATCCACTTTAACTCGAGTTAAAGTGGATCACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001207.3-599s1c1
Sequence:CCGGTGAGTCAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTGACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-417s1c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-484s1c1
Sequence:CCGGCCAAACAATCTGTGGATGGAACTCGAGTTCCATCCACAGATTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-357s1c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-186s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001207
VALIDATED
BTF3 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-384s21c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-419s21c1
Sequence:CCGGGACAAAGCAGCTGACAGAAATCTCGAGATTTCTGTCAGCTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-444s21c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-800s21c1
Sequence:CCGGTTCATTCTTTGCAGCTAATTACTCGAGTAATTAGCTGCAAAGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-338s21c1
Sequence:CCGGAGGAACAGTGATCCACTTTAACTCGAGTTAAAGTGGATCACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001207.3-599s1c1
Sequence:CCGGTGAGTCAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTGACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-417s1c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-484s1c1
Sequence:CCGGCCAAACAATCTGTGGATGGAACTCGAGTTCCATCCACAGATTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-357s1c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-186s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001207
VALIDATED
BTF3 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-384s21c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-419s21c1
Sequence:CCGGGACAAAGCAGCTGACAGAAATCTCGAGATTTCTGTCAGCTGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-444s21c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-800s21c1
Sequence:CCGGTTCATTCTTTGCAGCTAATTACTCGAGTAATTAGCTGCAAAGAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001207.4-338s21c1
Sequence:CCGGAGGAACAGTGATCCACTTTAACTCGAGTTAAAGTGGATCACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001207.3-599s1c1
Sequence:CCGGTGAGTCAACTTCTGAAGATAACTCGAGTTATCTTCAGAAGTTGACTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-417s1c1
Sequence:CCGGCCCAGCATCTTAAACCAGCTTCTCGAGAAGCTGGTTTAAGATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-484s1c1
Sequence:CCGGCCAAACAATCTGTGGATGGAACTCGAGTTCCATCCACAGATTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001207.3-357s1c1
Sequence:CCGGGCAGCGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001207.3-186s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTTCTCGAGAACCACCTTCTTCTTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks