EMAIL THIS PAGE TO A FRIEND

BTF3L4

basic transcription factor 3-like 4

186 Gene Product Result for
UniProtKB ID: Q96K17, B3KNJ1, D3DQ32, G3V1C6
Gene ID:
Mouse(70533) basic transcription factor 3-like 4
Rat(366434) basic transcription factor 3-like 4
sheep(101112859) basic transcription factor 3-like 4
naked mole-rat(101713696) basic transcription factor 3-like 4
domestic guinea pig(100723603) basic transcription factor 3-like 4
Zebrafish(393667) basic transcription factor 3-like 4
cow(539753) basic transcription factor 3-like 4
domestic cat(101090125) basic transcription factor 3-like 4
dog(475353) basic transcription factor 3-like 4
chicken(424638) basic transcription factor 3-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152265 Rosetta Predictions human pricing
XM_345561 Rosetta Predictions rat pricing
NM_027453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190272 predicted 547
2 SASI_Hs02_00365775 predicted 369
3 SASI_Hs01_00190267 predicted 331
4 SASI_Hs01_00190268 predicted 283
5 SASI_Hs01_00190269 predicted 235
6 SASI_Hs01_00190270 predicted 262
7 SASI_Hs01_00190271 predicted 331
8 SASI_Hs01_00190273 predicted 1009
9 SASI_Hs01_00190274 predicted 995
10 SASI_Hs01_00190275 predicted 546
11 SASI_Hs01_00190276 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398500 predicted 544
2 SASI_Rn02_00398501 predicted 721
3 SASI_Rn02_00398502 predicted 865
4 SASI_Rn02_00398503 predicted 733
5 SASI_Rn02_00398504 predicted 700
6 SASI_Rn02_00398505 predicted 761
7 SASI_Rn02_00398506 predicted 696
8 SASI_Rn02_00398507 predicted 602
9 SASI_Rn02_00398508 predicted 511
10 SASI_Rn02_00398509 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123122 predicted 585
2 SASI_Mm01_00123123 predicted 423
3 SASI_Mm01_00123124 predicted 437
4 SASI_Mm01_00123125 predicted 499
5 SASI_Mm01_00123126 predicted 406
6 SASI_Mm02_00332219 predicted 408
7 SASI_Mm01_00123127 predicted 322
8 SASI_Mm01_00123128 predicted 224
9 SASI_Mm01_00123129 predicted 581
10 SASI_Mm01_00123130 predicted 387
11 SASI_Mm01_00123131 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152265
VALIDATED
BTF3L4 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-1148s1c1
Sequence:CCGGGCTGGAGTAATGGGTAACATACTCGAGTATGTTACCCATTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-154s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTACTCGAGTACCACCTTCTTCTTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-454s1c1
Sequence:CCGGCGGCAAGTCTTGGACAGTAAACTCGAGTTTACTGTCCAAGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-414s1c1
Sequence:CCGGCAGTTTAACAAGCCTTAGGAACTCGAGTTCCTAAGGCTTGTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-230s1c1
Sequence:CCGGCTGTGAATAATATAGCTGGTACTCGAGTACCAGCTATATTATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-544s21c1
Sequence:GTACCGGGCATCAAAGAATGAAGCTAACCTCGAGGTTAGCTTCATTCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152265.2-985s21c1
Sequence:CCGGCCCGTAAGACACAGAATTAATCTCGAGATTAATTCTGTGTCTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-376s21c1
Sequence:CCGGGAAATGCTTCCTGGAATATTACTCGAGTAATATTCCAGGAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-276s21c1
Sequence:CCGGTGATGGGACAGTTATTCATTTCTCGAGAAATGAATAACTGTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152265
VALIDATED
BTF3L4 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-1148s1c1
Sequence:CCGGGCTGGAGTAATGGGTAACATACTCGAGTATGTTACCCATTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-154s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTACTCGAGTACCACCTTCTTCTTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-454s1c1
Sequence:CCGGCGGCAAGTCTTGGACAGTAAACTCGAGTTTACTGTCCAAGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-414s1c1
Sequence:CCGGCAGTTTAACAAGCCTTAGGAACTCGAGTTCCTAAGGCTTGTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-230s1c1
Sequence:CCGGCTGTGAATAATATAGCTGGTACTCGAGTACCAGCTATATTATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-544s21c1
Sequence:GTACCGGGCATCAAAGAATGAAGCTAACCTCGAGGTTAGCTTCATTCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152265.2-985s21c1
Sequence:CCGGCCCGTAAGACACAGAATTAATCTCGAGATTAATTCTGTGTCTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-376s21c1
Sequence:CCGGGAAATGCTTCCTGGAATATTACTCGAGTAATATTCCAGGAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-276s21c1
Sequence:CCGGTGATGGGACAGTTATTCATTTCTCGAGAAATGAATAACTGTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152265
VALIDATED
BTF3L4 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-1148s1c1
Sequence:CCGGGCTGGAGTAATGGGTAACATACTCGAGTATGTTACCCATTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-154s1c1
Sequence:CCGGCGCAGAAAGAAGAAGGTGGTACTCGAGTACCACCTTCTTCTTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152265.1-454s1c1
Sequence:CCGGCGGCAAGTCTTGGACAGTAAACTCGAGTTTACTGTCCAAGACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-414s1c1
Sequence:CCGGCAGTTTAACAAGCCTTAGGAACTCGAGTTCCTAAGGCTTGTTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152265.1-230s1c1
Sequence:CCGGCTGTGAATAATATAGCTGGTACTCGAGTACCAGCTATATTATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-544s21c1
Sequence:GTACCGGGCATCAAAGAATGAAGCTAACCTCGAGGTTAGCTTCATTCTTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152265.2-985s21c1
Sequence:CCGGCCCGTAAGACACAGAATTAATCTCGAGATTAATTCTGTGTCTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-376s21c1
Sequence:CCGGGAAATGCTTCCTGGAATATTACTCGAGTAATATTCCAGGAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152265.2-276s21c1
Sequence:CCGGTGATGGGACAGTTATTCATTTCTCGAGAAATGAATAACTGTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027453
VALIDATED
BTF3L4 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3-like 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-453s1c1
Sequence:CCGGCGGCAAGTATTGGATAGTAAACTCGAGTTTACTATCCAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-451s1c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-384s1c1
Sequence:CCGGCCTGGGATATTAAGTCAGCTTCTCGAGAAGCTGACTTAATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027453.1-2382s1c1
Sequence:CCGGCGGGCAATGTTGTAGATGAAACTCGAGTTTCATCTACAACATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-203s1c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-269s21c1
Sequence:CCGGTAAAGACGATGGCACGGTTATCTCGAGATAACCGTGCCATCGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-704s21c1
Sequence:CCGGCTCAGCAGTTCTCGGTCATTTCTCGAGAAATGACCGAGAACTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-451s21c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-203s21c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-325s21c1
Sequence:CCGGCCGCTAACACCTTTGCAATTACTCGAGTAATTGCAAAGGTGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027453
VALIDATED
BTF3L4 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3-like 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-453s1c1
Sequence:CCGGCGGCAAGTATTGGATAGTAAACTCGAGTTTACTATCCAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-451s1c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-384s1c1
Sequence:CCGGCCTGGGATATTAAGTCAGCTTCTCGAGAAGCTGACTTAATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027453.1-2382s1c1
Sequence:CCGGCGGGCAATGTTGTAGATGAAACTCGAGTTTCATCTACAACATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-203s1c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-269s21c1
Sequence:CCGGTAAAGACGATGGCACGGTTATCTCGAGATAACCGTGCCATCGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-704s21c1
Sequence:CCGGCTCAGCAGTTCTCGGTCATTTCTCGAGAAATGACCGAGAACTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-451s21c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-203s21c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-325s21c1
Sequence:CCGGCCGCTAACACCTTTGCAATTACTCGAGTAATTGCAAAGGTGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027453
VALIDATED
BTF3L4 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3-like 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-453s1c1
Sequence:CCGGCGGCAAGTATTGGATAGTAAACTCGAGTTTACTATCCAATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027453.1-451s1c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-384s1c1
Sequence:CCGGCCTGGGATATTAAGTCAGCTTCTCGAGAAGCTGACTTAATATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027453.1-2382s1c1
Sequence:CCGGCGGGCAATGTTGTAGATGAAACTCGAGTTTCATCTACAACATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027453.1-203s1c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-269s21c1
Sequence:CCGGTAAAGACGATGGCACGGTTATCTCGAGATAACCGTGCCATCGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-704s21c1
Sequence:CCGGCTCAGCAGTTCTCGGTCATTTCTCGAGAAATGACCGAGAACTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-451s21c1
Sequence:CCGGCACGGCAAGTATTGGATAGTACTCGAGTACTATCCAATACTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-203s21c1
Sequence:CCGGGCTTCAGAGTTCACTAAAGAACTCGAGTTCTTTAGTGAACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027453.2-325s21c1
Sequence:CCGGCCGCTAACACCTTTGCAATTACTCGAGTAATTGCAAAGGTGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks