EMAIL THIS PAGE TO A FRIEND

BTF3P10

basic transcription factor 3 pseudogene 10

Gene Product Result for
Synonyms: RAET1J
Species: Human BTF3P10(345829)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293984
BTF3P10 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3 pseudogene 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-197s1c1
Sequence:CCGGCTGGTATTGAAGAGGTGAATACTCGAGTATTCACCTCTTCAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-277s1c1
Sequence:CCGGGCAGGGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-27s1c1
Sequence:CCGGGATGAAAGAAACAATCACGAACTCGAGTTCGTGATTGTTTCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-361s1c1
Sequence:CCGGGTAGACAGTCTGGCTAGTTTACTCGAGTAAACTAGCCAGACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-337s1c1
Sequence:CCGGCCCAGCATCTTAATCCAGCTTCTCGAGAAGCTGGATTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293984
BTF3P10 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3 pseudogene 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-197s1c1
Sequence:CCGGCTGGTATTGAAGAGGTGAATACTCGAGTATTCACCTCTTCAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-277s1c1
Sequence:CCGGGCAGGGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-27s1c1
Sequence:CCGGGATGAAAGAAACAATCACGAACTCGAGTTCGTGATTGTTTCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-361s1c1
Sequence:CCGGGTAGACAGTCTGGCTAGTTTACTCGAGTAAACTAGCCAGACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-337s1c1
Sequence:CCGGCCCAGCATCTTAATCCAGCTTCTCGAGAAGCTGGATTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293984
BTF3P10 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3 pseudogene 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-197s1c1
Sequence:CCGGCTGGTATTGAAGAGGTGAATACTCGAGTATTCACCTCTTCAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-277s1c1
Sequence:CCGGGCAGGGAACACTTTCACCATTCTCGAGAATGGTGAAAGTGTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-27s1c1
Sequence:CCGGGATGAAAGAAACAATCACGAACTCGAGTTCGTGATTGTTTCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-361s1c1
Sequence:CCGGGTAGACAGTCTGGCTAGTTTACTCGAGTAAACTAGCCAGACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293984.3-337s1c1
Sequence:CCGGCCCAGCATCTTAATCCAGCTTCTCGAGAAGCTGGATTAAGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks