EMAIL THIS PAGE TO A FRIEND

BTF3P11

basic transcription factor 3 pseudogene 11

28 Gene Product Result for
Synonyms: BTF3L1 HUMBTFB OCIF OPG TNFRSF11B
Species: Human BTF3P11(690)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100231 Anti-BTF3L1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001208
BTF3P11 MISSION shRNA Bacterial Glycerol Stock
basic transcription factor 3 pseudogene 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-94s1c1
Sequence:CCGGCACACGACAGCAGAGGATAAACTCGAGTTTATCCTCTGCTGTCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-37s1c1
Sequence:CCGGCGGCAAGCAGAAGTGCACACTCTCGAGAGTGTGCACTTCTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-157s1c1
Sequence:CCGGCCTGGTATTGAAGAGGTGAATCTCGAGATTCACCTCTTCAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-50s1c1
Sequence:CCGGTGCACACTGGTCGGAAAGGAACTCGAGTTCCTTTCCGACCAGTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-145s1c1
Sequence:CCGGGTAAACAATATCCCTGGTATTCTCGAGAATACCAGGGATATTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001208
BTF3P11 MISSION shRNA shRNA Plasmid DNA
basic transcription factor 3 pseudogene 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-94s1c1
Sequence:CCGGCACACGACAGCAGAGGATAAACTCGAGTTTATCCTCTGCTGTCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-37s1c1
Sequence:CCGGCGGCAAGCAGAAGTGCACACTCTCGAGAGTGTGCACTTCTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-157s1c1
Sequence:CCGGCCTGGTATTGAAGAGGTGAATCTCGAGATTCACCTCTTCAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-50s1c1
Sequence:CCGGTGCACACTGGTCGGAAAGGAACTCGAGTTCCTTTCCGACCAGTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-145s1c1
Sequence:CCGGGTAAACAATATCCCTGGTATTCTCGAGAATACCAGGGATATTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001208
BTF3P11 MISSION shRNA Lentiviral Transduction Particles
basic transcription factor 3 pseudogene 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-94s1c1
Sequence:CCGGCACACGACAGCAGAGGATAAACTCGAGTTTATCCTCTGCTGTCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-37s1c1
Sequence:CCGGCGGCAAGCAGAAGTGCACACTCTCGAGAGTGTGCACTTCTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-157s1c1
Sequence:CCGGCCTGGTATTGAAGAGGTGAATCTCGAGATTCACCTCTTCAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-50s1c1
Sequence:CCGGTGCACACTGGTCGGAAAGGAACTCGAGTTCCTTTCCGACCAGTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001208.1-145s1c1
Sequence:CCGGGTAAACAATATCCCTGGTATTCTCGAGAATACCAGGGATATTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks