EMAIL THIS PAGE TO A FRIEND

BTG1

B-cell translocation gene 1, anti-proliferative

130 Gene Product Result for
UniProtKB ID: P62324, P31607
Gene ID:
Human(694) Summary: This gene is a member of an anti-proliferative gene family that regulates cell growth and differentiation. Expression of this gene is highest in the G0/G1 phases of the cell cycle and downregulated when cells progressed through G1. The encoded protein interacts with several nuclear receptors, and functions as a coactivator of cell differentiation. This locus has been shown to be involved in a t(8;12)(q24;q22) chromosomal translocation in a case of B-cell chronic lymphocytic leukemia. [provided by RefSeq, Oct 2008]
Mouse(12226) B cell translocation gene 1, anti-proliferative
Rat(29618) B-cell translocation gene 1, anti-proliferative
Zebrafish(114432) B-cell translocation gene 1
cow(281032) B-cell translocation gene 1, anti-proliferative
domestic cat(101101647) B-cell translocation gene 1, anti-proliferative
chicken(396295) B-cell translocation gene 1, anti-proliferative
domestic guinea pig(100730291) B-cell translocation gene 1, anti-proliferative
naked mole-rat(101730211) B-cell translocation gene 1, anti-proliferative
Goat(100861579) B-cell translocation gene 1, anti-proliferative
sheep(100217400) B-cell translocation gene 1, anti-proliferative
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001731 Rosetta Predictions human pricing
NM_017258 Rosetta Predictions rat pricing
NM_007569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223954 predicted 1288
2 SASI_Hs01_00223956 predicted 631
3 SASI_Hs01_00223957 predicted 581
4 SASI_Hs01_00223958 predicted 709
5 SASI_Hs02_00332435 predicted 583
6 SASI_Hs02_00332436 predicted 553
7 SASI_Hs01_00223953 predicted 1256
8 SASI_Hs01_00223955 predicted 661
9 SASI_Hs01_00223960 predicted 511
10 SASI_Hs01_00223961 predicted 836
11 SASI_Hs01_00223959 predicted 932
12 SASI_Hs01_00223962 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034666 predicted 253
2 SASI_Rn01_00034662 predicted 202
3 SASI_Rn01_00034663 predicted 266
4 SASI_Rn01_00034664 predicted 400
5 SASI_Rn01_00034668 predicted 787
6 SASI_Rn01_00034669 predicted 623
7 SASI_Rn01_00034670 predicted 616
8 SASI_Rn01_00034671 predicted 811
9 SASI_Rn02_00261652 predicted 721
10 SASI_Rn02_00261653 predicted 787
11 SASI_Rn01_00034665 predicted 414
12 SASI_Rn01_00034667 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142621 predicted 550
2 SASI_Mm01_00142622 predicted 514
3 SASI_Mm01_00142623 predicted 1212
4 SASI_Mm02_00311952 predicted 1212
5 SASI_Mm01_00142620 predicted 560
6 SASI_Mm01_00142624 predicted 815
7 SASI_Mm01_00142625 predicted 1015
8 SASI_Mm01_00142628 predicted 760
9 SASI_Mm01_00142629 predicted 802
10 SASI_Mm02_00311953 predicted 1107
11 SASI_Mm01_00142626 predicted 925
12 SASI_Mm01_00142627 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001731
VALIDATED
BTG1 MISSION shRNA Bacterial Glycerol Stock
B-cell translocation gene 1, anti-proliferative
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001731.x-941s1c1
Sequence:CCGGTGGCACAAGATAGAATGGTAACTCGAGTTACCATTCTATCTTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001731.x-359s1c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-728s1c1
Sequence:CCGGGCAAATGGTAGACAGCCGAATCTCGAGATTCGGCTGTCTACCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-727s1c1
Sequence:CCGGTGCAAATGGTAGACAGCCGAACTCGAGTTCGGCTGTCTACCATTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-370s1c1
Sequence:CCGGTCATCTCCAAGTTTCTCCGCACTCGAGTGCGGAGAAACTTGGAGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-497s21c1
Sequence:CCGGGGAGCTGCTGGCAGAACATTACTCGAGTAATGTTCTGCCAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-858s21c1
Sequence:CCGGATGATGACTGTATCAGGTTAACTCGAGTTAACCTGATACAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-552s21c1
Sequence:CCGGGGATCGGGTTACCGTTGTATTCTCGAGAATACAACGGTAACCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-1081s21c1
Sequence:CCGGTAGCCTGTGAGTCCAAGTAAACTCGAGTTTACTTGGACTCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-413s21c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001731
VALIDATED
BTG1 MISSION shRNA shRNA Plasmid DNA
B-cell translocation gene 1, anti-proliferative
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001731.x-941s1c1
Sequence:CCGGTGGCACAAGATAGAATGGTAACTCGAGTTACCATTCTATCTTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001731.x-359s1c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-728s1c1
Sequence:CCGGGCAAATGGTAGACAGCCGAATCTCGAGATTCGGCTGTCTACCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-727s1c1
Sequence:CCGGTGCAAATGGTAGACAGCCGAACTCGAGTTCGGCTGTCTACCATTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-370s1c1
Sequence:CCGGTCATCTCCAAGTTTCTCCGCACTCGAGTGCGGAGAAACTTGGAGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-497s21c1
Sequence:CCGGGGAGCTGCTGGCAGAACATTACTCGAGTAATGTTCTGCCAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-858s21c1
Sequence:CCGGATGATGACTGTATCAGGTTAACTCGAGTTAACCTGATACAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-552s21c1
Sequence:CCGGGGATCGGGTTACCGTTGTATTCTCGAGAATACAACGGTAACCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-1081s21c1
Sequence:CCGGTAGCCTGTGAGTCCAAGTAAACTCGAGTTTACTTGGACTCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-413s21c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001731
VALIDATED
BTG1 MISSION shRNA Lentiviral Transduction Particles
B-cell translocation gene 1, anti-proliferative
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001731.x-941s1c1
Sequence:CCGGTGGCACAAGATAGAATGGTAACTCGAGTTACCATTCTATCTTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001731.x-359s1c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-728s1c1
Sequence:CCGGGCAAATGGTAGACAGCCGAATCTCGAGATTCGGCTGTCTACCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-727s1c1
Sequence:CCGGTGCAAATGGTAGACAGCCGAACTCGAGTTCGGCTGTCTACCATTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001731.x-370s1c1
Sequence:CCGGTCATCTCCAAGTTTCTCCGCACTCGAGTGCGGAGAAACTTGGAGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-497s21c1
Sequence:CCGGGGAGCTGCTGGCAGAACATTACTCGAGTAATGTTCTGCCAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-858s21c1
Sequence:CCGGATGATGACTGTATCAGGTTAACTCGAGTTAACCTGATACAGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001731.2-552s21c1
Sequence:CCGGGGATCGGGTTACCGTTGTATTCTCGAGAATACAACGGTAACCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-1081s21c1
Sequence:CCGGTAGCCTGTGAGTCCAAGTAAACTCGAGTTTACTTGGACTCACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001731.2-413s21c1
Sequence:CCGGCGCCGTGTCCTTCATCTCCAACTCGAGTTGGAGATGAAGGACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007569
VALIDATED
BTG1 MISSION shRNA Bacterial Glycerol Stock
B-cell translocation gene 1, anti-proliferative
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-499s1c1
Sequence:CCGGCCGTTGTATTCGCATCAACCACTCGAGTGGTTGATGCGAATACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-444s1c1
Sequence:CCGGCAGAACATTACAAACATCACTCTCGAGAGTGATGTTTGTAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-518s1c1
Sequence:CCGGCATAAGATGGATCCTCTGATTCTCGAGAATCAGAGGATCCATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007569.1-351s1c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-483s1c1
Sequence:CCGGGCAAGGGATCAGGTTACCGTTCTCGAGAACGGTAACCTGATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-590s21c1
Sequence:CCGGTGAGCAGTCAGGAGTTGTTCACTCGAGTGAACAACTCCTGACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-738s21c1
Sequence:CCGGCAACGTGCAAATGGTAGACAGCTCGAGCTGTCTACCATTTGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007569.2-833s21c1
Sequence:CCGGCAGGTTAAGATATAGTCTATTCTCGAGAATAGACTATATCTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-377s21c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007569.2-1138s21c1
Sequence:CCGGCCAGACCTTATACCCAATTTGCTCGAGCAAATTGGGTATAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007569
VALIDATED
BTG1 MISSION shRNA shRNA Plasmid DNA
B-cell translocation gene 1, anti-proliferative
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-499s1c1
Sequence:CCGGCCGTTGTATTCGCATCAACCACTCGAGTGGTTGATGCGAATACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-444s1c1
Sequence:CCGGCAGAACATTACAAACATCACTCTCGAGAGTGATGTTTGTAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-518s1c1
Sequence:CCGGCATAAGATGGATCCTCTGATTCTCGAGAATCAGAGGATCCATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007569.1-351s1c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-483s1c1
Sequence:CCGGGCAAGGGATCAGGTTACCGTTCTCGAGAACGGTAACCTGATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-590s21c1
Sequence:CCGGTGAGCAGTCAGGAGTTGTTCACTCGAGTGAACAACTCCTGACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-738s21c1
Sequence:CCGGCAACGTGCAAATGGTAGACAGCTCGAGCTGTCTACCATTTGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007569.2-833s21c1
Sequence:CCGGCAGGTTAAGATATAGTCTATTCTCGAGAATAGACTATATCTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-377s21c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007569.2-1138s21c1
Sequence:CCGGCCAGACCTTATACCCAATTTGCTCGAGCAAATTGGGTATAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007569
VALIDATED
BTG1 MISSION shRNA Lentiviral Transduction Particles
B-cell translocation gene 1, anti-proliferative
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-499s1c1
Sequence:CCGGCCGTTGTATTCGCATCAACCACTCGAGTGGTTGATGCGAATACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-444s1c1
Sequence:CCGGCAGAACATTACAAACATCACTCTCGAGAGTGATGTTTGTAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-518s1c1
Sequence:CCGGCATAAGATGGATCCTCTGATTCTCGAGAATCAGAGGATCCATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007569.1-351s1c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007569.1-483s1c1
Sequence:CCGGGCAAGGGATCAGGTTACCGTTCTCGAGAACGGTAACCTGATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-590s21c1
Sequence:CCGGTGAGCAGTCAGGAGTTGTTCACTCGAGTGAACAACTCCTGACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-738s21c1
Sequence:CCGGCAACGTGCAAATGGTAGACAGCTCGAGCTGTCTACCATTTGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007569.2-833s21c1
Sequence:CCGGCAGGTTAAGATATAGTCTATTCTCGAGAATAGACTATATCTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007569.2-377s21c1
Sequence:CCGGCGGTGTCCTTCATCTCCAAGTCTCGAGACTTGGAGATGAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007569.2-1138s21c1
Sequence:CCGGCCAGACCTTATACCCAATTTGCTCGAGCAAATTGGGTATAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks