EMAIL THIS PAGE TO A FRIEND

BTG2

BTG family, member 2

201 Gene Product Result for
Synonyms: PC3 TIS21
UniProtKB ID: P78543, Q3KR25, Q5VUT0
Gene ID:
Human(7832) Summary: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein is involved in the regulation of the G1/S transition of the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(12227) B cell translocation gene 2, anti-proliferative
Rat(29619) BTG family, member 2
Zebrafish(30079) B-cell translocation gene 2
cow(539364) BTG family, member 2
domestic cat(101082205) BTG family, member 2
dog(488559) BTG family, member 2
chicken(419932) BTG family, member 2
sheep(100620047) BTG family, member 2
naked mole-rat(101702273) BTG family, member 2
domestic guinea pig(100727139) BTG family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006763 Rosetta Predictions human pricing
NM_017259 Rosetta Predictions rat pricing
NM_007570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021544 predicted 952
2 SASI_Hs01_00021545 predicted 892
3 SASI_Hs01_00021546 predicted 201
4 SASI_Hs01_00021547 predicted 890
5 SASI_Hs01_00021549 predicted 763
6 SASI_Hs01_00021550 predicted 944
7 SASI_Hs01_00021551 predicted 205
8 SASI_Hs01_00021553 predicted 86
9 SASI_Hs02_00342261 predicted 86
10 SASI_Hs02_00342262 predicted 239
11 SASI_Hs01_00021548 predicted 987
12 SASI_Hs01_00021552 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083722 predicted 992
2 SASI_Rn01_00083723 predicted 955
3 SASI_Rn01_00083724 predicted 239
4 SASI_Rn01_00083726 predicted 200
5 SASI_Rn01_00083727 predicted 993
6 SASI_Rn02_00261654 predicted 831
7 SASI_Rn01_00083728 predicted 517
8 SASI_Rn01_00083729 predicted 190
9 SASI_Rn01_00083730 predicted 244
10 SASI_Rn01_00083731 predicted 251
11 SASI_Rn01_00083725 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150344 predicted 1042
2 SASI_Mm01_00150345 predicted 1028
3 SASI_Mm01_00150346 predicted 1002
4 SASI_Mm01_00150347 predicted 930
5 SASI_Mm01_00150348 predicted 291
6 SASI_Mm01_00150349 predicted 235
7 SASI_Mm01_00150350 predicted 1038
8 SASI_Mm01_00150351 predicted 301
9 SASI_Mm01_00150352 predicted 867
10 SASI_Mm01_00150353 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006763
BTG2 MISSION shRNA Bacterial Glycerol Stock
BTG family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006763.2-1561s21c1
Sequence:CCGGGGTCATAGAGCTACCGTATTTCTCGAGAAATACGGTAGCTCTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-391s21c1
Sequence:CCGGATGAGGTGTCCTACCGCATTGCTCGAGCAATGCGGTAGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-166s21c1
Sequence:CCGGAGCAGAGGCTTAAGGTCTTCACTCGAGTGAAGACCTTAAGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-263s21c1
Sequence:CCGGCTACCGCTGCATTCGCATCAACTCGAGTTGATGCGAATGCAGCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-205s21c1
Sequence:CCGGCACTCACAGAGCACTACAAACCTCGAGGTTTGTAGTGCTCTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006763.2-1116s1c1
Sequence:CCGGCCTACTGTCCTAAGCTGCTTTCTCGAGAAAGCAGCTTAGGACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-158s1c1
Sequence:CCGGCGTGAGCGAGCAGAGGCTTAACTCGAGTTAAGCCTCTGCTCGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-518s1c1
Sequence:CCGGCAAGAACTACGTGATGGCAGTCTCGAGACTGCCATCACGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-216s1c1
Sequence:CCGGCACTACAAACACCACTGGTTTCTCGAGAAACCAGTGGTGTTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-389s1c1
Sequence:CCGGCTATGAGGTGTCCTACCGCATCTCGAGATGCGGTAGGACACCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006763
BTG2 MISSION shRNA shRNA Plasmid DNA
BTG family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006763.2-1561s21c1
Sequence:CCGGGGTCATAGAGCTACCGTATTTCTCGAGAAATACGGTAGCTCTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-391s21c1
Sequence:CCGGATGAGGTGTCCTACCGCATTGCTCGAGCAATGCGGTAGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-166s21c1
Sequence:CCGGAGCAGAGGCTTAAGGTCTTCACTCGAGTGAAGACCTTAAGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-263s21c1
Sequence:CCGGCTACCGCTGCATTCGCATCAACTCGAGTTGATGCGAATGCAGCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-205s21c1
Sequence:CCGGCACTCACAGAGCACTACAAACCTCGAGGTTTGTAGTGCTCTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006763.2-1116s1c1
Sequence:CCGGCCTACTGTCCTAAGCTGCTTTCTCGAGAAAGCAGCTTAGGACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-158s1c1
Sequence:CCGGCGTGAGCGAGCAGAGGCTTAACTCGAGTTAAGCCTCTGCTCGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-518s1c1
Sequence:CCGGCAAGAACTACGTGATGGCAGTCTCGAGACTGCCATCACGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-216s1c1
Sequence:CCGGCACTACAAACACCACTGGTTTCTCGAGAAACCAGTGGTGTTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-389s1c1
Sequence:CCGGCTATGAGGTGTCCTACCGCATCTCGAGATGCGGTAGGACACCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006763
BTG2 MISSION shRNA Lentiviral Transduction Particles
BTG family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006763.2-1561s21c1
Sequence:CCGGGGTCATAGAGCTACCGTATTTCTCGAGAAATACGGTAGCTCTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-391s21c1
Sequence:CCGGATGAGGTGTCCTACCGCATTGCTCGAGCAATGCGGTAGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-166s21c1
Sequence:CCGGAGCAGAGGCTTAAGGTCTTCACTCGAGTGAAGACCTTAAGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-263s21c1
Sequence:CCGGCTACCGCTGCATTCGCATCAACTCGAGTTGATGCGAATGCAGCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006763.2-205s21c1
Sequence:CCGGCACTCACAGAGCACTACAAACCTCGAGGTTTGTAGTGCTCTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006763.2-1116s1c1
Sequence:CCGGCCTACTGTCCTAAGCTGCTTTCTCGAGAAAGCAGCTTAGGACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-158s1c1
Sequence:CCGGCGTGAGCGAGCAGAGGCTTAACTCGAGTTAAGCCTCTGCTCGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-518s1c1
Sequence:CCGGCAAGAACTACGTGATGGCAGTCTCGAGACTGCCATCACGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-216s1c1
Sequence:CCGGCACTACAAACACCACTGGTTTCTCGAGAAACCAGTGGTGTTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006763.2-389s1c1
Sequence:CCGGCTATGAGGTGTCCTACCGCATCTCGAGATGCGGTAGGACACCTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007570
VALIDATED
BTG2 MISSION shRNA Bacterial Glycerol Stock
BTG family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007570.2-1447s21c1
Sequence:CCGGCTGAATGCTGCTACCACTATTCTCGAGAATAGTGGTAGCAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-562s21c1
Sequence:CCGGATGGCCGTCTCCAGCTAGATACTCGAGTATCTAGCTGGAGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-194s21c1
Sequence:CCGGGCGAGCAGAGACTCAAGGTTTCTCGAGAAACCTTGAGTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-286s21c1
Sequence:CCGGGGTTCTGGCTATCGCTGTATCCTCGAGGATACAGCGATAGCCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-231s21c1
Sequence:CCGGGGACGCACTGACCGATCATTACTCGAGTAATGATCGGTCAGTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-384s1c1
Sequence:CCGGCTATGAAGTGTCTTACCGCATCTCGAGATGCGGTAAGACACTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007570.1-2240s1c1
Sequence:CCGGGCCTACAACAAAGCTGTGAATCTCGAGATTCACAGCTTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-241s1c1
Sequence:CCGGCCATCCAAAGGTTCTGGCTATCTCGAGATAGCCAGAACCTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-199s1c1
Sequence:CCGGGCACTGACCGATCATTACAAACTCGAGTTTGTAATGATCGGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-258s1c1
Sequence:CCGGCTATCGCTGTATCCGTATCAACTCGAGTTGATACGGATACAGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007570
VALIDATED
BTG2 MISSION shRNA shRNA Plasmid DNA
BTG family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007570.2-1447s21c1
Sequence:CCGGCTGAATGCTGCTACCACTATTCTCGAGAATAGTGGTAGCAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-562s21c1
Sequence:CCGGATGGCCGTCTCCAGCTAGATACTCGAGTATCTAGCTGGAGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-194s21c1
Sequence:CCGGGCGAGCAGAGACTCAAGGTTTCTCGAGAAACCTTGAGTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-286s21c1
Sequence:CCGGGGTTCTGGCTATCGCTGTATCCTCGAGGATACAGCGATAGCCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-231s21c1
Sequence:CCGGGGACGCACTGACCGATCATTACTCGAGTAATGATCGGTCAGTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-384s1c1
Sequence:CCGGCTATGAAGTGTCTTACCGCATCTCGAGATGCGGTAAGACACTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007570.1-2240s1c1
Sequence:CCGGGCCTACAACAAAGCTGTGAATCTCGAGATTCACAGCTTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-241s1c1
Sequence:CCGGCCATCCAAAGGTTCTGGCTATCTCGAGATAGCCAGAACCTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-199s1c1
Sequence:CCGGGCACTGACCGATCATTACAAACTCGAGTTTGTAATGATCGGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-258s1c1
Sequence:CCGGCTATCGCTGTATCCGTATCAACTCGAGTTGATACGGATACAGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007570
VALIDATED
BTG2 MISSION shRNA Lentiviral Transduction Particles
BTG family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007570.2-1447s21c1
Sequence:CCGGCTGAATGCTGCTACCACTATTCTCGAGAATAGTGGTAGCAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-562s21c1
Sequence:CCGGATGGCCGTCTCCAGCTAGATACTCGAGTATCTAGCTGGAGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-194s21c1
Sequence:CCGGGCGAGCAGAGACTCAAGGTTTCTCGAGAAACCTTGAGTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-286s21c1
Sequence:CCGGGGTTCTGGCTATCGCTGTATCCTCGAGGATACAGCGATAGCCAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007570.2-231s21c1
Sequence:CCGGGGACGCACTGACCGATCATTACTCGAGTAATGATCGGTCAGTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-384s1c1
Sequence:CCGGCTATGAAGTGTCTTACCGCATCTCGAGATGCGGTAAGACACTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007570.1-2240s1c1
Sequence:CCGGGCCTACAACAAAGCTGTGAATCTCGAGATTCACAGCTTTGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007570.1-241s1c1
Sequence:CCGGCCATCCAAAGGTTCTGGCTATCTCGAGATAGCCAGAACCTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-199s1c1
Sequence:CCGGGCACTGACCGATCATTACAAACTCGAGTTTGTAATGATCGGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007570.1-258s1c1
Sequence:CCGGCTATCGCTGTATCCGTATCAACTCGAGTTGATACGGATACAGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks