EMAIL THIS PAGE TO A FRIEND

BTG3

BTG family, member 3

85 Gene Product Result for
Synonyms: ANA TOB5 TOB55 TOFA
UniProtKB ID: Q14201, D3DSC4, Q53XV1, Q96ET7
Gene ID:
Human(10950) Summary: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(12228) B cell translocation gene 3
Rat(54230) BTG family, member 3
domestic guinea pig(100732837) BTG family, member 3
sheep(100620049) BTG family, member 3
Zebrafish(492479) B-cell translocation gene 3
cow(541054) BTG family, member 3
domestic cat(101089792) BTG family, member 3
dog(487695) BTG family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006806 Rosetta Predictions human pricing
NM_019290 Rosetta Predictions rat pricing
NM_009770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077043 predicted 776
2 SASI_Hs01_00077044 predicted 244
3 SASI_Hs01_00077045 predicted 349
4 SASI_Hs01_00077046 predicted 239
5 SASI_Hs01_00077047 predicted 622
6 SASI_Hs01_00077048 predicted 999
7 SASI_Hs01_00077049 predicted 826
8 SASI_Hs01_00077050 predicted 539
9 SASI_Hs01_00077051 predicted 304
10 SASI_Hs02_00342327 predicted 873
11 SASI_Hs01_00077042 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262239 predicted 344
2 SASI_Rn01_00074156 predicted 228
3 SASI_Rn01_00074157 predicted 430
4 SASI_Rn01_00074158 predicted 503
5 SASI_Rn01_00074159 predicted 549
6 SASI_Rn01_00074160 predicted 287
7 SASI_Rn01_00074162 predicted 412
8 SASI_Rn01_00074163 predicted 559
9 SASI_Rn01_00074164 predicted 260
10 SASI_Rn01_00074165 predicted 448
11 SASI_Rn01_00074161 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028711 predicted 515
2 SASI_Mm01_00028712 predicted 676
3 SASI_Mm01_00028713 predicted 335
4 SASI_Mm01_00028714 predicted 579
5 SASI_Mm01_00028715 predicted 696
6 SASI_Mm02_00316977 predicted 514
7 SASI_Mm01_00028716 predicted 590
8 SASI_Mm01_00028717 predicted 858
9 SASI_Mm01_00028718 predicted 388
10 SASI_Mm02_00316978 predicted 700
11 SASI_Mm01_00028719 predicted 842
12 SASI_Mm01_00028720 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009770
BTG3 MISSION shRNA Bacterial Glycerol Stock
BTG family, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009770.1-1250s1c1
Sequence:CCGGGCGATGTGTTCTAGCACCTTTCTCGAGAAAGGTGCTAGAACACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.1-375s1c1
Sequence:CCGGGTCAATAAGTTTCAGAGAGTTCTCGAGAACTCTCTGAAACTTATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-906s1c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-551s1c1
Sequence:CCGGGGACGAGAACAAGGATGAAATCTCGAGATTTCATCCTTGTTCTCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-906s21c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-652s21c1
Sequence:CCGGGCAAGGAAGTGGACGTGAAACCTCGAGGTTTCACGTCCACTTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009770.2-987s21c1
Sequence:CCGGGAAGACATACCTTCCTATATACTCGAGTATATAGGAAGGTATGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-850s21c1
Sequence:CCGGATAAACCATTCCGCCCAATTCCTCGAGGAATTGGGCGGAATGGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-708s21c1
Sequence:CCGGCAGATTTCAGAACTGATATTCCTCGAGGAATATCAGTTCTGAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009770
BTG3 MISSION shRNA shRNA Plasmid DNA
BTG family, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009770.1-1250s1c1
Sequence:CCGGGCGATGTGTTCTAGCACCTTTCTCGAGAAAGGTGCTAGAACACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.1-375s1c1
Sequence:CCGGGTCAATAAGTTTCAGAGAGTTCTCGAGAACTCTCTGAAACTTATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-906s1c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-551s1c1
Sequence:CCGGGGACGAGAACAAGGATGAAATCTCGAGATTTCATCCTTGTTCTCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-906s21c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-652s21c1
Sequence:CCGGGCAAGGAAGTGGACGTGAAACCTCGAGGTTTCACGTCCACTTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009770.2-987s21c1
Sequence:CCGGGAAGACATACCTTCCTATATACTCGAGTATATAGGAAGGTATGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-850s21c1
Sequence:CCGGATAAACCATTCCGCCCAATTCCTCGAGGAATTGGGCGGAATGGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-708s21c1
Sequence:CCGGCAGATTTCAGAACTGATATTCCTCGAGGAATATCAGTTCTGAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009770
BTG3 MISSION shRNA Lentiviral Transduction Particles
BTG family, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009770.1-1250s1c1
Sequence:CCGGGCGATGTGTTCTAGCACCTTTCTCGAGAAAGGTGCTAGAACACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.1-375s1c1
Sequence:CCGGGTCAATAAGTTTCAGAGAGTTCTCGAGAACTCTCTGAAACTTATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-906s1c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009770.2-551s1c1
Sequence:CCGGGGACGAGAACAAGGATGAAATCTCGAGATTTCATCCTTGTTCTCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-906s21c1
Sequence:CCGGGACCGAAATCACTGGATTAATCTCGAGATTAATCCAGTGATTTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-652s21c1
Sequence:CCGGGCAAGGAAGTGGACGTGAAACCTCGAGGTTTCACGTCCACTTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009770.2-987s21c1
Sequence:CCGGGAAGACATACCTTCCTATATACTCGAGTATATAGGAAGGTATGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-850s21c1
Sequence:CCGGATAAACCATTCCGCCCAATTCCTCGAGGAATTGGGCGGAATGGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009770.2-708s21c1
Sequence:CCGGCAGATTTCAGAACTGATATTCCTCGAGGAATATCAGTTCTGAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006806
VALIDATED
BTG3 MISSION shRNA Bacterial Glycerol Stock
BTG family, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-1223s1c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-484s1c1
Sequence:CCGGGCATTCATTGTTGCCAGCTTTCTCGAGAAAGCTGGCAACAATGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-661s1c1
Sequence:CCGGCCTGTGTACCAGATTTCAGAACTCGAGTTCTGAAATCTGGTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-244s1c1
Sequence:CCGGGCTGAGAAATTGACCCTAATACTCGAGTATTAGGGTCAATTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-730s1c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-975s21c1
Sequence:CCGGGACCGGAATCACTGGATTAATCTCGAGATTAATCCAGTGATTCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-432s21c1
Sequence:CCGGAGATGTATTCGTGTCAATAAACTCGAGTTTATTGACACGAATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006806.4-1330s21c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-837s21c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-919s21c1
Sequence:CCGGATAAACCATATCGCCCAATTCCTCGAGGAATTGGGCGATATGGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006806
VALIDATED
BTG3 MISSION shRNA shRNA Plasmid DNA
BTG family, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-1223s1c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-484s1c1
Sequence:CCGGGCATTCATTGTTGCCAGCTTTCTCGAGAAAGCTGGCAACAATGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-661s1c1
Sequence:CCGGCCTGTGTACCAGATTTCAGAACTCGAGTTCTGAAATCTGGTACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-244s1c1
Sequence:CCGGGCTGAGAAATTGACCCTAATACTCGAGTATTAGGGTCAATTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-730s1c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-975s21c1
Sequence:CCGGGACCGGAATCACTGGATTAATCTCGAGATTAATCCAGTGATTCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-432s21c1
Sequence:CCGGAGATGTATTCGTGTCAATAAACTCGAGTTTATTGACACGAATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006806.4-1330s21c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-837s21c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-919s21c1
Sequence:CCGGATAAACCATATCGCCCAATTCCTCGAGGAATTGGGCGATATGGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006806
VALIDATED
BTG3 MISSION shRNA Lentiviral Transduction Particles
BTG family, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-1223s1c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-484s1c1
Sequence:CCGGGCATTCATTGTTGCCAGCTTTCTCGAGAAAGCTGGCAACAATGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006806.3-661s1c1
Sequence:CCGGCCTGTGTACCAGATTTCAGAACTCGAGTTCTGAAATCTGGTACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-244s1c1
Sequence:CCGGGCTGAGAAATTGACCCTAATACTCGAGTATTAGGGTCAATTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006806.3-730s1c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-975s21c1
Sequence:CCGGGACCGGAATCACTGGATTAATCTCGAGATTAATCCAGTGATTCCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-432s21c1
Sequence:CCGGAGATGTATTCGTGTCAATAAACTCGAGTTTATTGACACGAATACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006806.4-1330s21c1
Sequence:CCGGGCACCTTTGAGAATTTACTTTCTCGAGAAAGTAAATTCTCAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-837s21c1
Sequence:CCGGCCAGGAATGTATCGAGGGAATCTCGAGATTCCCTCGATACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006806.4-919s21c1
Sequence:CCGGATAAACCATATCGCCCAATTCCTCGAGGAATTGGGCGATATGGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)