EMAIL THIS PAGE TO A FRIEND

BTG4

B-cell translocation gene 4

60 Gene Product Result for
Synonyms: PC3B
UniProtKB ID: Q9NY30
Gene ID:
Human(54766) Summary: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein can induce G1 arrest in the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(56057) B cell translocation gene 4
Rat(315650) B-cell translocation gene 4
Zebrafish(378946) B-cell translocation gene 4
chicken(419781) B-cell translocation gene 4
cow(519995) B-cell translocation gene 4
domestic cat(101091649) B-cell translocation gene 4
dog(489412) B-cell translocation gene 4
sheep(101107134) B-cell translocation gene 4
naked mole-rat(101717914) B-cell translocation gene 4
domestic guinea pig(100718872) B-cell translocation gene 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017589 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140961 MISSION® esiRNA esiRNA human BTG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017589 Rosetta Predictions human pricing
NM_001013176 Rosetta Predictions rat pricing
NM_019493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107250 predicted 312
2 SASI_Hs01_00107251 predicted 509
3 SASI_Hs01_00107252 predicted 462
4 SASI_Hs01_00107253 predicted 375
5 SASI_Hs01_00107254 predicted 508
6 SASI_Hs01_00107255 predicted 643
7 SASI_Hs01_00107256 predicted 557
8 SASI_Hs01_00107257 predicted 318
9 SASI_Hs01_00107258 predicted 363
10 SASI_Hs02_00350254 predicted 567
11 SASI_Hs01_00107259 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092655 predicted 486
2 SASI_Rn01_00092656 predicted 484
3 SASI_Rn01_00092657 predicted 469
4 SASI_Rn01_00092658 predicted 492
5 SASI_Rn01_00092659 predicted 475
6 SASI_Rn01_00092660 predicted 484
7 SASI_Rn01_00092661 predicted 461
8 SASI_Rn02_00200930 predicted 474
9 SASI_Rn01_00092662 predicted 445
10 SASI_Rn01_00092663 predicted 484
11 SASI_Rn01_00092664 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174160 predicted 500
2 SASI_Mm01_00174161 predicted 1044
3 SASI_Mm01_00174162 predicted 547
4 SASI_Mm01_00174163 predicted 549
5 SASI_Mm01_00174164 predicted 885
6 SASI_Mm01_00174165 predicted 495
7 SASI_Mm01_00174166 predicted 521
8 SASI_Mm01_00174167 predicted 853
9 SASI_Mm01_00174168 predicted 606
10 SASI_Mm01_00174169 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017589
BTG4 MISSION shRNA Bacterial Glycerol Stock
B-cell translocation gene 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c1
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c1
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-714s1c1
Sequence:CCGGCCCTTTCAATCTTGGTTACAACTCGAGTTGTAACCAAGATTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-678s1c1
Sequence:CCGGCCGAAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-324s1c1
Sequence:CCGGCACTCTGATTGCCCTTCTAAACTCGAGTTTAGAAGGGCAATCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-648s1c1
Sequence:CCGGGAACCTCGTGTCATTCCTAAACTCGAGTTTAGGAATGACACGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c2
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-625s1c1
Sequence:CCGGGCGATGAAGAAAGTTGTAGCACTCGAGTGCTACAACTTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-356s1c1
Sequence:CCGGCAGGTGCATCAGGATAAACAACTCGAGTTGTTTATCCTGATGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-774s1c1
Sequence:CCGGCTCCTGGGAAACACTTACCATCTCGAGATGGTAAGTGTTTCCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-215s1c1
Sequence:CCGGCTTTGTCACAAGATTGGTGAACTCGAGTTCACCAATCTTGTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c2
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017589
BTG4 MISSION shRNA shRNA Plasmid DNA
B-cell translocation gene 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c1
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c1
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-714s1c1
Sequence:CCGGCCCTTTCAATCTTGGTTACAACTCGAGTTGTAACCAAGATTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-678s1c1
Sequence:CCGGCCGAAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-324s1c1
Sequence:CCGGCACTCTGATTGCCCTTCTAAACTCGAGTTTAGAAGGGCAATCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-648s1c1
Sequence:CCGGGAACCTCGTGTCATTCCTAAACTCGAGTTTAGGAATGACACGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c2
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-625s1c1
Sequence:CCGGGCGATGAAGAAAGTTGTAGCACTCGAGTGCTACAACTTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-356s1c1
Sequence:CCGGCAGGTGCATCAGGATAAACAACTCGAGTTGTTTATCCTGATGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-774s1c1
Sequence:CCGGCTCCTGGGAAACACTTACCATCTCGAGATGGTAAGTGTTTCCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-215s1c1
Sequence:CCGGCTTTGTCACAAGATTGGTGAACTCGAGTTCACCAATCTTGTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c2
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017589
BTG4 MISSION shRNA Lentiviral Transduction Particles
B-cell translocation gene 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c1
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c1
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-714s1c1
Sequence:CCGGCCCTTTCAATCTTGGTTACAACTCGAGTTGTAACCAAGATTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-678s1c1
Sequence:CCGGCCGAAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-324s1c1
Sequence:CCGGCACTCTGATTGCCCTTCTAAACTCGAGTTTAGAAGGGCAATCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-648s1c1
Sequence:CCGGGAACCTCGTGTCATTCCTAAACTCGAGTTTAGGAATGACACGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-323s1c2
Sequence:CCGGGCACTCTGATTGCCCTTCTAACTCGAGTTAGAAGGGCAATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017589.2-625s1c1
Sequence:CCGGGCGATGAAGAAAGTTGTAGCACTCGAGTGCTACAACTTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-356s1c1
Sequence:CCGGCAGGTGCATCAGGATAAACAACTCGAGTTGTTTATCCTGATGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-774s1c1
Sequence:CCGGCTCCTGGGAAACACTTACCATCTCGAGATGGTAAGTGTTTCCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-215s1c1
Sequence:CCGGCTTTGTCACAAGATTGGTGAACTCGAGTTCACCAATCTTGTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017589.2-626s1c2
Sequence:CCGGCGATGAAGAAAGTTGTAGCAACTCGAGTTGCTACAACTTTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019493
BTG4 MISSION shRNA Bacterial Glycerol Stock
B-cell translocation gene 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-708s1c1
Sequence:CCGGGAACAACCCAAAGAGCGTCTACTCGAGTAGACGCTCTTTGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019493.2-1183s1c1
Sequence:CCGGGAATTATAGGAAGGAAGACTTCTCGAGAAGTCTTCCTTCCTATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-282s1c1
Sequence:CCGGGAAACTGAGTACTCAACAGATCTCGAGATCTGTTGAGTACTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-778s1c1
Sequence:CCGGCGTAGAAAGCATTTGGCAGATCTCGAGATCTGCCAAATGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019493.2-1154s1c1
Sequence:CCGGCAGAGATGTTGCCGGTGATAACTCGAGTTATCACCGGCAACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019493.2-653s1c1
Sequence:CCGGGCACATCTTCTGATGAAGAAACTCGAGTTTCTTCATCAGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019493
BTG4 MISSION shRNA shRNA Plasmid DNA
B-cell translocation gene 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-708s1c1
Sequence:CCGGGAACAACCCAAAGAGCGTCTACTCGAGTAGACGCTCTTTGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019493.2-1183s1c1
Sequence:CCGGGAATTATAGGAAGGAAGACTTCTCGAGAAGTCTTCCTTCCTATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-282s1c1
Sequence:CCGGGAAACTGAGTACTCAACAGATCTCGAGATCTGTTGAGTACTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-778s1c1
Sequence:CCGGCGTAGAAAGCATTTGGCAGATCTCGAGATCTGCCAAATGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019493.2-1154s1c1
Sequence:CCGGCAGAGATGTTGCCGGTGATAACTCGAGTTATCACCGGCAACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019493.2-653s1c1
Sequence:CCGGGCACATCTTCTGATGAAGAAACTCGAGTTTCTTCATCAGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019493
BTG4 MISSION shRNA Lentiviral Transduction Particles
B-cell translocation gene 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-708s1c1
Sequence:CCGGGAACAACCCAAAGAGCGTCTACTCGAGTAGACGCTCTTTGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019493.2-1183s1c1
Sequence:CCGGGAATTATAGGAAGGAAGACTTCTCGAGAAGTCTTCCTTCCTATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-282s1c1
Sequence:CCGGGAAACTGAGTACTCAACAGATCTCGAGATCTGTTGAGTACTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019493.2-778s1c1
Sequence:CCGGCGTAGAAAGCATTTGGCAGATCTCGAGATCTGCCAAATGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019493.2-1154s1c1
Sequence:CCGGCAGAGATGTTGCCGGTGATAACTCGAGTTATCACCGGCAACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019493.2-653s1c1
Sequence:CCGGGCACATCTTCTGATGAAGAAACTCGAGTTTCTTCATCAGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks