EMAIL THIS PAGE TO A FRIEND

BTK

Bruton agammaglobulinemia tyrosine kinase

97 Gene Product Result for
Synonyms: AGMX1 AT ATK BPK IMD1 PSCTK1 XLA
UniProtKB ID: Q06187, Q32ML5
Gene ID:
Human(695) Summary: The protein encoded by this gene plays a crucial role in B-cell development. Mutations in this gene cause X-linked agammaglobulinemia type 1, which is an immunodeficiency characterized by the failure to produce mature B lymphocytes, and associated with a failure of Ig heavy chain rearrangement. [provided by RefSeq, Nov 2008]
Mouse(12229) Bruton agammaglobulinemia tyrosine kinase
Rat(367901) Bruton agammaglobulinemia tyrosine kinase
Zebrafish(568653) Bruton agammaglobulinemia tyrosine kinase
cow(533459) Bruton agammaglobulinemia tyrosine kinase
Horse(100057626) Bruton agammaglobulinemia tyrosine kinase
domestic cat(101088062) Bruton agammaglobulinemia tyrosine kinase
dog(492019) Bruton agammaglobulinemia tyrosine kinase
chicken(374075) Bruton agammaglobulinemia tyrosine kinase
domestic guinea pig(100714123) Bruton agammaglobulinemia tyrosine kinase
naked mole-rat(101715242) Bruton agammaglobulinemia tyrosine kinase
sheep(101105725) Bruton agammaglobulinemia tyrosine kinase
Domestic Rabbit(100354225) Bruton agammaglobulinemia tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B3187 Anti-BTK (270-284) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B3312 Anti-BTK (594-608) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA001198 Anti-BTK antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA002028 Anti-BTK antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500372 Anti-BTK antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
SAB4502936 Anti-BTK antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
B0811 Anti-BTK, C-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
B0686 Anti-BTK, N-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
SAB4503801 Anti-phospho-BTK (pTyr223) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301227 Anti-phospho-BTK (pTyr223) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4503802 Anti-phospho-BTK (pTyr551) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB5300137 Monoclonal Anti-BTK antibody produced in mouse clone 7F12H4, ascites fluid monkey, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0938 Phosphotyrosine BTK / Tyrosine-protein Kinase BTK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000061 Rosetta Predictions human pricing
NM_001007798 Rosetta Predictions rat pricing
NM_013482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096334 predicted 1252
2 SASI_Hs01_00096335 predicted 1949
3 SASI_Hs01_00096336 predicted 273
4 SASI_Hs01_00096337 predicted 1065
5 SASI_Hs01_00096338 predicted 1351
6 SASI_Hs01_00096339 predicted 313
7 SASI_Hs01_00096340 predicted 2073
8 SASI_Hs01_00096341 predicted 2235
9 SASI_Hs01_00096342 predicted 1265
10 SASI_Hs01_00096343 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068001 predicted 656
2 SASI_Rn01_00068002 predicted 575
3 SASI_Rn01_00068003 predicted 1627
4 SASI_Rn01_00068004 predicted 1101
5 SASI_Rn01_00068005 predicted 1225
6 SASI_Rn02_00198958 predicted 1193
7 SASI_Rn01_00068006 predicted 1433
8 SASI_Rn01_00068008 predicted 285
9 SASI_Rn01_00068009 predicted 1570
10 SASI_Rn01_00068010 predicted 1084
11 SASI_Rn01_00068007 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192395 predicted 1272
2 SASI_Mm01_00192396 predicted 1354
3 SASI_Mm01_00192397 predicted 731
4 SASI_Mm01_00192398 predicted 1262
5 SASI_Mm01_00192399 predicted 1587
6 SASI_Mm01_00192400 predicted 302
7 SASI_Mm01_00192401 predicted 1246
8 SASI_Mm01_00192402 predicted 1949
9 SASI_Mm01_00192403 predicted 1391
10 SASI_Mm01_00192404 predicted 1724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000061
BTK MISSION shRNA Bacterial Glycerol Stock
Bruton agammaglobulinemia tyrosine kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-265s1c1
Sequence:CCGGGCACAAACTCTCCTACTATGACTCGAGTCATAGTAGGAGAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000061.1-2373s1c1
Sequence:CCGGCAGACTGAATTTGCGATGAAACTCGAGTTTCATCGCAAATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-389s1c1
Sequence:CCGGGAAAGACAGATTCCGAGAAGACTCGAGTCTTCTCGGAATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1873s1c2
Sequence:CCGGGTATAGCAAGTTCAGCAGCAACTCGAGTTGCTGCTGAACTTGCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1066s1c1
Sequence:CCGGAGGAGGTTTCATTGTCAGAGACTCGAGTCTCTGACAATGAAACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1266s1c1
Sequence:CCGGGACTCATATCCAGGCTCAAATCTCGAGATTTGAGCCTGGATATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-591s1c1
Sequence:CCGGACCCTTGCTTCTGGATCGATGCTCGAGCATCGATCCAGAAGCAAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000061.x-2490s1c1
Sequence:CCGGGTGGACCGAATTTGGCAAGAACTCGAGTTCTTGCCAAATTCGGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-974s1c1
Sequence:CCGGGAAGCAGAAGACTCCATAGAACTCGAGTTCTATGGAGTCTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-842s1c1
Sequence:CCGGCCAATGAATGCAAATGATCTACTCGAGTAGATCATTTGCATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000061.1-2237s21c1
Sequence:CCGGCTTTGTGCTCCCACTCAATACCTCGAGGTATTGAGTGGGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2135s21c1
Sequence:CCGGGAATCCTGAGCTCGCCAATAACTCGAGTTATTGGCGAGCTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2025s21c1
Sequence:CCGGTGGCTTCAGAGAAGGTATATACTCGAGTATATACCTTCTCTGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1268s21c1
Sequence:CCGGCTCATATCCAGGCTCAAATATCTCGAGATATTTGAGCCTGGATATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1222s21c1
Sequence:CCGGCACCATCCCTGAGCTCATTAACTCGAGTTAATGAGCTCAGGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000061
BTK MISSION shRNA shRNA Plasmid DNA
Bruton agammaglobulinemia tyrosine kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-265s1c1
Sequence:CCGGGCACAAACTCTCCTACTATGACTCGAGTCATAGTAGGAGAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000061.1-2373s1c1
Sequence:CCGGCAGACTGAATTTGCGATGAAACTCGAGTTTCATCGCAAATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-389s1c1
Sequence:CCGGGAAAGACAGATTCCGAGAAGACTCGAGTCTTCTCGGAATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1873s1c2
Sequence:CCGGGTATAGCAAGTTCAGCAGCAACTCGAGTTGCTGCTGAACTTGCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1066s1c1
Sequence:CCGGAGGAGGTTTCATTGTCAGAGACTCGAGTCTCTGACAATGAAACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1266s1c1
Sequence:CCGGGACTCATATCCAGGCTCAAATCTCGAGATTTGAGCCTGGATATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-591s1c1
Sequence:CCGGACCCTTGCTTCTGGATCGATGCTCGAGCATCGATCCAGAAGCAAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000061.x-2490s1c1
Sequence:CCGGGTGGACCGAATTTGGCAAGAACTCGAGTTCTTGCCAAATTCGGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-974s1c1
Sequence:CCGGGAAGCAGAAGACTCCATAGAACTCGAGTTCTATGGAGTCTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-842s1c1
Sequence:CCGGCCAATGAATGCAAATGATCTACTCGAGTAGATCATTTGCATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000061.1-2237s21c1
Sequence:CCGGCTTTGTGCTCCCACTCAATACCTCGAGGTATTGAGTGGGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2135s21c1
Sequence:CCGGGAATCCTGAGCTCGCCAATAACTCGAGTTATTGGCGAGCTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2025s21c1
Sequence:CCGGTGGCTTCAGAGAAGGTATATACTCGAGTATATACCTTCTCTGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1268s21c1
Sequence:CCGGCTCATATCCAGGCTCAAATATCTCGAGATATTTGAGCCTGGATATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1222s21c1
Sequence:CCGGCACCATCCCTGAGCTCATTAACTCGAGTTAATGAGCTCAGGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000061
BTK MISSION shRNA Lentiviral Transduction Particles
Bruton agammaglobulinemia tyrosine kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-265s1c1
Sequence:CCGGGCACAAACTCTCCTACTATGACTCGAGTCATAGTAGGAGAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000061.1-2373s1c1
Sequence:CCGGCAGACTGAATTTGCGATGAAACTCGAGTTTCATCGCAAATTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000061.1-389s1c1
Sequence:CCGGGAAAGACAGATTCCGAGAAGACTCGAGTCTTCTCGGAATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1873s1c2
Sequence:CCGGGTATAGCAAGTTCAGCAGCAACTCGAGTTGCTGCTGAACTTGCTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1066s1c1
Sequence:CCGGAGGAGGTTTCATTGTCAGAGACTCGAGTCTCTGACAATGAAACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-1266s1c1
Sequence:CCGGGACTCATATCCAGGCTCAAATCTCGAGATTTGAGCCTGGATATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-591s1c1
Sequence:CCGGACCCTTGCTTCTGGATCGATGCTCGAGCATCGATCCAGAAGCAAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000061.x-2490s1c1
Sequence:CCGGGTGGACCGAATTTGGCAAGAACTCGAGTTCTTGCCAAATTCGGTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-974s1c1
Sequence:CCGGGAAGCAGAAGACTCCATAGAACTCGAGTTCTATGGAGTCTTCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000061.x-842s1c1
Sequence:CCGGCCAATGAATGCAAATGATCTACTCGAGTAGATCATTTGCATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000061.1-2237s21c1
Sequence:CCGGCTTTGTGCTCCCACTCAATACCTCGAGGTATTGAGTGGGAGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2135s21c1
Sequence:CCGGGAATCCTGAGCTCGCCAATAACTCGAGTTATTGGCGAGCTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-2025s21c1
Sequence:CCGGTGGCTTCAGAGAAGGTATATACTCGAGTATATACCTTCTCTGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1268s21c1
Sequence:CCGGCTCATATCCAGGCTCAAATATCTCGAGATATTTGAGCCTGGATATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000061.1-1222s21c1
Sequence:CCGGCACCATCCCTGAGCTCATTAACTCGAGTTAATGAGCTCAGGGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013482
BTK MISSION shRNA Bacterial Glycerol Stock
Bruton agammaglobulinemia tyrosine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-799s1c1
Sequence:CCGGCCTTTATGATTACATGCCAATCTCGAGATTGGCATGTAATCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1709s1c1
Sequence:CCGGCGAAACTGTTTGGTAAACGATCTCGAGATCGTTTACCAAACAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1924s1c1
Sequence:CCGGGCCGTATGAGAGATTTACTAACTCGAGTTAGTAAATCTCTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-218s1c1
Sequence:CCGGCGCCTGTTTCTCTTGACTGTACTCGAGTACAGTCAAGAGAAACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-929s1c1
Sequence:CCGGCCAAGTAACTATATCACTGAACTCGAGTTCAGTGATATAGTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-947s21c1
Sequence:CCGGTACATCCCAAGTAACTATATCCTCGAGGATATAGTTACTTGGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-864s21c1
Sequence:CCGGTGCGAAAGGGCGAGGAGTATTCTCGAGAATACTCCTCGCCCTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-457s21c1
Sequence:CCGGGTACCCATTCCAGGTTGTATACTCGAGTATACAACCTGGAATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-2022s21c1
Sequence:CCGGTGGCATCAGAGAGGGTATATACTCGAGTATATACCCTCTCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013482
BTK MISSION shRNA shRNA Plasmid DNA
Bruton agammaglobulinemia tyrosine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-799s1c1
Sequence:CCGGCCTTTATGATTACATGCCAATCTCGAGATTGGCATGTAATCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1709s1c1
Sequence:CCGGCGAAACTGTTTGGTAAACGATCTCGAGATCGTTTACCAAACAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1924s1c1
Sequence:CCGGGCCGTATGAGAGATTTACTAACTCGAGTTAGTAAATCTCTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-218s1c1
Sequence:CCGGCGCCTGTTTCTCTTGACTGTACTCGAGTACAGTCAAGAGAAACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-929s1c1
Sequence:CCGGCCAAGTAACTATATCACTGAACTCGAGTTCAGTGATATAGTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-947s21c1
Sequence:CCGGTACATCCCAAGTAACTATATCCTCGAGGATATAGTTACTTGGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-864s21c1
Sequence:CCGGTGCGAAAGGGCGAGGAGTATTCTCGAGAATACTCCTCGCCCTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-457s21c1
Sequence:CCGGGTACCCATTCCAGGTTGTATACTCGAGTATACAACCTGGAATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-2022s21c1
Sequence:CCGGTGGCATCAGAGAGGGTATATACTCGAGTATATACCCTCTCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013482
BTK MISSION shRNA Lentiviral Transduction Particles
Bruton agammaglobulinemia tyrosine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-799s1c1
Sequence:CCGGCCTTTATGATTACATGCCAATCTCGAGATTGGCATGTAATCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1709s1c1
Sequence:CCGGCGAAACTGTTTGGTAAACGATCTCGAGATCGTTTACCAAACAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-1924s1c1
Sequence:CCGGGCCGTATGAGAGATTTACTAACTCGAGTTAGTAAATCTCTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-218s1c1
Sequence:CCGGCGCCTGTTTCTCTTGACTGTACTCGAGTACAGTCAAGAGAAACAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013482.1-929s1c1
Sequence:CCGGCCAAGTAACTATATCACTGAACTCGAGTTCAGTGATATAGTTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-947s21c1
Sequence:CCGGTACATCCCAAGTAACTATATCCTCGAGGATATAGTTACTTGGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-864s21c1
Sequence:CCGGTGCGAAAGGGCGAGGAGTATTCTCGAGAATACTCCTCGCCCTTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-457s21c1
Sequence:CCGGGTACCCATTCCAGGTTGTATACTCGAGTATACAACCTGGAATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013482.2-2022s21c1
Sequence:CCGGTGGCATCAGAGAGGGTATATACTCGAGTATATACCCTCTCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks