EMAIL THIS PAGE TO A FRIEND

BTLA

B and T lymphocyte associated

103 Gene Product Result for
Synonyms: BTLA1 CD272
UniProtKB ID: Q7Z6A9, Q3B831, Q3HS85, Q6ZNH9
Gene ID:
Human(151888) Summary: This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
Mouse(208154) B and T lymphocyte associated
Rat(407756) B and T lymphocyte associated
chicken(418426) B and T lymphocyte associated
dog(487975) B and T lymphocyte associated
cow(531767) B and T lymphocyte associated
domestic cat(101088181) B and T lymphocyte associated
sheep(101120975) B and T lymphocyte associated
naked mole-rat(101698891) B and T lymphocyte associated
domestic guinea pig(100732201) B and T lymphocyte associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085357 Rosetta Predictions human pricing
NM_181780 Rosetta Predictions human pricing
NM_213630 Rosetta Predictions rat pricing
NM_001037719 Rosetta Predictions mouse pricing
NM_177584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317472 predicted 1177
2 SASI_Hs02_00317473 predicted 859
3 SASI_Hs02_00317474 predicted 1095
4 SASI_Hs02_00317475 predicted 285
5 SASI_Hs02_00317476 predicted 344
6 SASI_Hs02_00317477 predicted 991
7 SASI_Hs02_00317478 predicted 953
8 SASI_Hs02_00317479 predicted 1160
9 SASI_Hs02_00317480 predicted 1216
10 SASI_Hs02_00317481 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370375 predicted 1317
2 SASI_Hs01_00029715 predicted 1001
3 SASI_Hs02_00370376 predicted 1234
4 SASI_Hs01_00029710 predicted 288
5 SASI_Hs01_00029712 predicted 337
6 SASI_Hs02_00370377 predicted 1133
7 SASI_Hs02_00370378 predicted 1094
8 SASI_Hs02_00370379 predicted 1308
9 SASI_Hs02_00370380 predicted 1352
10 SASI_Hs02_00370381 predicted 1327
11 SASI_Hs01_00029711 predicted 781
12 SASI_Hs01_00029713 predicted 773
13 SASI_Hs01_00029714 predicted 826
14 SASI_Hs01_00029716 predicted 952
15 SASI_Hs01_00029717 predicted 543
16 SASI_Hs01_00029718 predicted 345
17 SASI_Hs01_00029719 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032334 predicted 358
2 SASI_Rn01_00032335 predicted 451
3 SASI_Rn01_00032336 predicted 500
4 SASI_Rn01_00032337 predicted 210
5 SASI_Rn01_00032338 predicted 589
6 SASI_Rn01_00032339 predicted 451
7 SASI_Rn01_00032340 predicted 700
8 SASI_Rn01_00032341 predicted 607
9 SASI_Rn01_00032342 predicted 366
10 SASI_Rn01_00032343 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165774 predicted 1069
2 SASI_Mm01_00165775 predicted 1055
3 SASI_Mm01_00165776 predicted 814
4 SASI_Mm01_00165777 predicted 787
5 SASI_Mm01_00165778 predicted 229
6 SASI_Mm02_00289340 predicted 824
7 SASI_Mm01_00165779 predicted 894
8 SASI_Mm01_00165780 predicted 1142
9 SASI_Mm01_00165781 predicted 807
10 SASI_Mm01_00165782 predicted 779
11 SASI_Mm01_00165783 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119377 predicted 1065
2 SASI_Mm01_00119378 predicted 1055
3 SASI_Mm01_00119379 predicted 806
4 SASI_Mm01_00119380 predicted 786
5 SASI_Mm01_00119381 predicted 230
6 SASI_Mm02_00347760 predicted 824
7 SASI_Mm01_00119382 predicted 891
8 SASI_Mm01_00119383 predicted 1146
9 SASI_Mm01_00119384 predicted 806
10 SASI_Mm01_00119385 predicted 772
11 SASI_Mm01_00119386 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181780
BTLA MISSION shRNA Bacterial Glycerol Stock
B and T lymphocyte associated
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181780.3-537s21c1
Sequence:CCGGTCATACCGCTGTTCTGCAAATCTCGAGATTTGCAGAACAGCGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1325s21c1
Sequence:CCGGCAGAATAGTAGAACGTTTAAACTCGAGTTTAAACGTTCTACTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1475s21c1
Sequence:CCGGTTTGACTAACCAACCATAAATCTCGAGATTTATGGTTGGTTAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1194s21c1
Sequence:CCGGTGTTAGTGCTTGGGTCTTAAGCTCGAGCTTAAGACCCAAGCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181780.1-152s1c1
Sequence:CCGGGAGATCCCTTTGAACTAGAATCTCGAGATTCTAGTTCAAAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-163s1c1
Sequence:CCGGGAACTAGAATGCCCTGTGAAACTCGAGTTTCACAGGGCATTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-85s1c1
Sequence:CCGGCATGGGAAAGAATCATGTGATCTCGAGATCACATGATTCTTTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-488s1c1
Sequence:CCGGGATTGCCTCTACTCATCACTACTCGAGTAGTGATGAGTAGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-570s1c1
Sequence:CCGGCACAGCAGGAAGGGAAATTAACTCGAGTTAATTTCCCTTCCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181780
BTLA MISSION shRNA shRNA Plasmid DNA
B and T lymphocyte associated
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181780.3-537s21c1
Sequence:CCGGTCATACCGCTGTTCTGCAAATCTCGAGATTTGCAGAACAGCGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1325s21c1
Sequence:CCGGCAGAATAGTAGAACGTTTAAACTCGAGTTTAAACGTTCTACTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1475s21c1
Sequence:CCGGTTTGACTAACCAACCATAAATCTCGAGATTTATGGTTGGTTAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1194s21c1
Sequence:CCGGTGTTAGTGCTTGGGTCTTAAGCTCGAGCTTAAGACCCAAGCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181780.1-152s1c1
Sequence:CCGGGAGATCCCTTTGAACTAGAATCTCGAGATTCTAGTTCAAAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-163s1c1
Sequence:CCGGGAACTAGAATGCCCTGTGAAACTCGAGTTTCACAGGGCATTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-85s1c1
Sequence:CCGGCATGGGAAAGAATCATGTGATCTCGAGATCACATGATTCTTTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-488s1c1
Sequence:CCGGGATTGCCTCTACTCATCACTACTCGAGTAGTGATGAGTAGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-570s1c1
Sequence:CCGGCACAGCAGGAAGGGAAATTAACTCGAGTTAATTTCCCTTCCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181780
BTLA MISSION shRNA Lentiviral Transduction Particles
B and T lymphocyte associated
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181780.3-537s21c1
Sequence:CCGGTCATACCGCTGTTCTGCAAATCTCGAGATTTGCAGAACAGCGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1325s21c1
Sequence:CCGGCAGAATAGTAGAACGTTTAAACTCGAGTTTAAACGTTCTACTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1475s21c1
Sequence:CCGGTTTGACTAACCAACCATAAATCTCGAGATTTATGGTTGGTTAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181780.3-1194s21c1
Sequence:CCGGTGTTAGTGCTTGGGTCTTAAGCTCGAGCTTAAGACCCAAGCACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181780.1-152s1c1
Sequence:CCGGGAGATCCCTTTGAACTAGAATCTCGAGATTCTAGTTCAAAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-163s1c1
Sequence:CCGGGAACTAGAATGCCCTGTGAAACTCGAGTTTCACAGGGCATTCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-85s1c1
Sequence:CCGGCATGGGAAAGAATCATGTGATCTCGAGATCACATGATTCTTTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-488s1c1
Sequence:CCGGGATTGCCTCTACTCATCACTACTCGAGTAGTGATGAGTAGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181780.1-570s1c1
Sequence:CCGGCACAGCAGGAAGGGAAATTAACTCGAGTTAATTTCCCTTCCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177584
BTLA MISSION shRNA Bacterial Glycerol Stock
B and T lymphocyte associated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-673s21c1
Sequence:CCGGGGACACTAACCTGGTTGATATCTCGAGATATCAACCAGGTTAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.3-462s1c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177584.3-2008s21c1
Sequence:CCGGTTTCCGGATTGAGTCTAATTACTCGAGTAATTAGACTCAATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-462s21c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-364s21c1
Sequence:CCGGCAGTGATAATGGGTCGTATAGCTCGAGCTATACGACCCATTATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-130s21c1
Sequence:CCGGAGAGTGTCCAGTGCAACTTACCTCGAGGTAAGTTGCACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-355s1c1
Sequence:CCGGCCAATACATCTCAGTGATAATCTCGAGATTATCACTGAGATGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177584.2-2240s1c1
Sequence:CCGGCCTGGAAATAAGACAAGAGAACTCGAGTTCTCTTGTCTTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-901s1c1
Sequence:CCGGCCCACAGAATATGCATCCATTCTCGAGAATGGATGCATATTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177584
BTLA MISSION shRNA shRNA Plasmid DNA
B and T lymphocyte associated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-673s21c1
Sequence:CCGGGGACACTAACCTGGTTGATATCTCGAGATATCAACCAGGTTAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.3-462s1c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177584.3-2008s21c1
Sequence:CCGGTTTCCGGATTGAGTCTAATTACTCGAGTAATTAGACTCAATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-462s21c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-364s21c1
Sequence:CCGGCAGTGATAATGGGTCGTATAGCTCGAGCTATACGACCCATTATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-130s21c1
Sequence:CCGGAGAGTGTCCAGTGCAACTTACCTCGAGGTAAGTTGCACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-355s1c1
Sequence:CCGGCCAATACATCTCAGTGATAATCTCGAGATTATCACTGAGATGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177584.2-2240s1c1
Sequence:CCGGCCTGGAAATAAGACAAGAGAACTCGAGTTCTCTTGTCTTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-901s1c1
Sequence:CCGGCCCACAGAATATGCATCCATTCTCGAGAATGGATGCATATTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177584
BTLA MISSION shRNA Lentiviral Transduction Particles
B and T lymphocyte associated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-673s21c1
Sequence:CCGGGGACACTAACCTGGTTGATATCTCGAGATATCAACCAGGTTAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.3-462s1c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177584.3-2008s21c1
Sequence:CCGGTTTCCGGATTGAGTCTAATTACTCGAGTAATTAGACTCAATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-462s21c1
Sequence:CCGGCTTCAGAACACCCACTAATAACTCGAGTTATTAGTGGGTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-364s21c1
Sequence:CCGGCAGTGATAATGGGTCGTATAGCTCGAGCTATACGACCCATTATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177584.3-130s21c1
Sequence:CCGGAGAGTGTCCAGTGCAACTTACCTCGAGGTAAGTTGCACTGGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-355s1c1
Sequence:CCGGCCAATACATCTCAGTGATAATCTCGAGATTATCACTGAGATGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177584.2-2240s1c1
Sequence:CCGGCCTGGAAATAAGACAAGAGAACTCGAGTTCTCTTGTCTTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177584.2-901s1c1
Sequence:CCGGCCCACAGAATATGCATCCATTCTCGAGAATGGATGCATATTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks