EMAIL THIS PAGE TO A FRIEND

BTN1A1

butyrophilin, subfamily 1, member A1

181 Gene Product Result for
Synonyms: BT BTN
UniProtKB ID: Q13410, Q4VAN3, Q4VAN4, Q9H458
Gene ID:
Human(696) Summary: Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
Mouse(12231) butyrophilin, subfamily 1, member A1
Rat(306956) butyrophilin, subfamily 1, member A1
naked mole-rat(101697974) butyrophilin, subfamily 1, member A1
domestic guinea pig(100734990) butyrophilin, subfamily 1, member A1
Goat(100860762) butyrophilin, subfamily 1, member A1
sheep(101107826) butyrophilin, subfamily 1, member A1
chicken(420061) butyrophilin, subfamily 1, member A1
cow(282157) butyrophilin, subfamily 1, member A1
Horse(100065802) butyrophilin, subfamily 1, member A1
domestic cat(101085974) butyrophilin, subfamily 1, member A1
dog(488282) butyrophilin, subfamily 1, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001732 Rosetta Predictions human pricing
XM_001072409 Rosetta Predictions rat pricing
XM_225365 Rosetta Predictions rat pricing
NM_013483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148766 predicted 488
2 SASI_Hs01_00148767 predicted 856
3 SASI_Hs01_00148768 predicted 1584
4 SASI_Hs02_00332437 predicted 967
5 SASI_Hs01_00148771 predicted 1200
6 SASI_Hs01_00148772 predicted 566
7 SASI_Hs01_00148765 predicted 635
8 SASI_Hs01_00148773 predicted 957
9 SASI_Hs01_00148774 predicted 1314
10 SASI_Hs02_00332438 predicted 1548
11 SASI_Hs01_00148769 predicted 825
12 SASI_Hs01_00148770 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339047 predicted 843
2 SASI_Rn02_00339048 predicted 436
3 SASI_Rn02_00339049 predicted 756
4 SASI_Rn02_00339050 predicted 612
5 SASI_Rn02_00339051 predicted 1053
6 SASI_Rn02_00339052 predicted 801
7 SASI_Rn02_00339053 predicted 734
8 SASI_Rn02_00339054 predicted 1068
9 SASI_Rn02_00339055 predicted 964
10 SASI_Rn02_00339056 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382763 predicted 840
2 SASI_Rn02_00382764 predicted 430
3 SASI_Rn02_00382765 predicted 757
4 SASI_Rn02_00382766 predicted 612
5 SASI_Rn02_00382767 predicted 1057
6 SASI_Rn02_00382768 predicted 798
7 SASI_Rn02_00382769 predicted 731
8 SASI_Rn02_00382770 predicted 1065
9 SASI_Rn02_00382771 predicted 965
10 SASI_Rn02_00382772 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063968 predicted 1673
2 SASI_Mm01_00063969 predicted 1215
3 SASI_Mm01_00063970 predicted 996
4 SASI_Mm01_00063971 predicted 1059
5 SASI_Mm01_00063972 predicted 1035
6 SASI_Mm02_00322120 predicted 914
7 SASI_Mm01_00063974 predicted 460
8 SASI_Mm02_00322121 predicted 1461
9 SASI_Mm02_00322122 predicted 1214
10 SASI_Mm01_00063975 predicted 482
11 SASI_Mm01_00063973 predicted 1501
12 SASI_Mm01_00063976 predicted 2176
13 SASI_Mm01_00063977 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001732
BTN1A1 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 1, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1063s1c1
Sequence:CCGGCGTCAGAAACTGCCTGAGAAACTCGAGTTTCTCAGGCAGTTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-138s1c1
Sequence:CCGGCAAACTGGATTCAGCTCCCTTCTCGAGAAGGGAGCTGAATCCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-875s1c1
Sequence:CCGGCTTGGAGACTATACAACGAAACTCGAGTTTCGTTGTATAGTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1542s1c1
Sequence:CCGGCCTTTCTAAGGAGATCCCATTCTCGAGAATGGGATCTCCTTAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-514s1c1
Sequence:CCGGCCTCACATCAGTATGCAAGTTCTCGAGAACTTGCATACTGATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001732
BTN1A1 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 1, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1063s1c1
Sequence:CCGGCGTCAGAAACTGCCTGAGAAACTCGAGTTTCTCAGGCAGTTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-138s1c1
Sequence:CCGGCAAACTGGATTCAGCTCCCTTCTCGAGAAGGGAGCTGAATCCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-875s1c1
Sequence:CCGGCTTGGAGACTATACAACGAAACTCGAGTTTCGTTGTATAGTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1542s1c1
Sequence:CCGGCCTTTCTAAGGAGATCCCATTCTCGAGAATGGGATCTCCTTAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-514s1c1
Sequence:CCGGCCTCACATCAGTATGCAAGTTCTCGAGAACTTGCATACTGATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001732
BTN1A1 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 1, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1063s1c1
Sequence:CCGGCGTCAGAAACTGCCTGAGAAACTCGAGTTTCTCAGGCAGTTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-138s1c1
Sequence:CCGGCAAACTGGATTCAGCTCCCTTCTCGAGAAGGGAGCTGAATCCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-875s1c1
Sequence:CCGGCTTGGAGACTATACAACGAAACTCGAGTTTCGTTGTATAGTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-1542s1c1
Sequence:CCGGCCTTTCTAAGGAGATCCCATTCTCGAGAATGGGATCTCCTTAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001732.1-514s1c1
Sequence:CCGGCCTCACATCAGTATGCAAGTTCTCGAGAACTTGCATACTGATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013483
BTN1A1 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 1, member A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013483.1-2897s1c1
Sequence:CCGGCCCTGCTTGTTTGAGAGCAATCTCGAGATTGCTCTCAAACAAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1081s1c1
Sequence:CCGGGCCTTAGGATTTCTCACCATTCTCGAGAATGGTGAGAAATCCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1152s1c1
Sequence:CCGGGAAGAAGGAATTTGGCTCTAACTCGAGTTAGAGCCAAATTCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1370s1c1
Sequence:CCGGCCTTTACTTCAGGGAGACATTCTCGAGAATGTCTCCCTGAAGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1635s1c1
Sequence:CCGGCGGATCTCTTATCTATACTTTCTCGAGAAAGTATAGATAAGAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013483
BTN1A1 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 1, member A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013483.1-2897s1c1
Sequence:CCGGCCCTGCTTGTTTGAGAGCAATCTCGAGATTGCTCTCAAACAAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1081s1c1
Sequence:CCGGGCCTTAGGATTTCTCACCATTCTCGAGAATGGTGAGAAATCCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1152s1c1
Sequence:CCGGGAAGAAGGAATTTGGCTCTAACTCGAGTTAGAGCCAAATTCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1370s1c1
Sequence:CCGGCCTTTACTTCAGGGAGACATTCTCGAGAATGTCTCCCTGAAGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1635s1c1
Sequence:CCGGCGGATCTCTTATCTATACTTTCTCGAGAAAGTATAGATAAGAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013483
BTN1A1 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 1, member A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013483.1-2897s1c1
Sequence:CCGGCCCTGCTTGTTTGAGAGCAATCTCGAGATTGCTCTCAAACAAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1081s1c1
Sequence:CCGGGCCTTAGGATTTCTCACCATTCTCGAGAATGGTGAGAAATCCTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1152s1c1
Sequence:CCGGGAAGAAGGAATTTGGCTCTAACTCGAGTTAGAGCCAAATTCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1370s1c1
Sequence:CCGGCCTTTACTTCAGGGAGACATTCTCGAGAATGTCTCCCTGAAGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013483.1-1635s1c1
Sequence:CCGGCGGATCTCTTATCTATACTTTCTCGAGAAAGTATAGATAAGAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)