EMAIL THIS PAGE TO A FRIEND

BTN2A1

butyrophilin, subfamily 2, member A1

68 Gene Product Result for
Synonyms: BK14H9.1 BT2.1 BTF1 DJ3E1.1
Gene ID:
Human(11120) Summary: This gene encodes a member of the immunoglobulin superfamily. The gene is located in a cluster of butyrophilin-like genes in the juxta-telomeric region of the major histocompatibility complex on chromosome 6. A pseudogene of this gene has been identified in this cluster. The encoded protein is an integral plasma membrane protein involved in lipid, fatty-acid, and sterol metabolism. Alterations in this gene may be associated with several disease states including metabolic syndrome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
cow(617928) butyrophilin, subfamily 2, member A1
sheep(101103021) butyrophilin, subfamily 2, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007049 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007049 Rosetta Predictions human pricing
NM_078476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093028 predicted 2081
2 SASI_Hs01_00093029 predicted 2084
3 SASI_Hs01_00093030 predicted 545
4 SASI_Hs01_00093031 predicted 2053
5 SASI_Hs01_00093032 predicted 2095
6 SASI_Hs01_00093033 predicted 2056
7 SASI_Hs01_00093034 predicted 963
8 SASI_Hs01_00093035 predicted 1057
9 SASI_Hs01_00093036 predicted 1052
10 SASI_Hs01_00093037 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110048 predicted 624
2 SASI_Hs01_00110049 predicted 937
3 SASI_Hs01_00110050 predicted 958
4 SASI_Hs01_00110051 predicted 570
5 SASI_Hs01_00110052 predicted 962
6 SASI_Hs01_00110053 predicted 541
7 SASI_Hs01_00110055 predicted 537
8 SASI_Hs01_00110054 predicted 765
9 SASI_Hs01_00110056 predicted 962
10 SASI_Hs01_00110057 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007049
BTN2A1 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 2, member A1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-965s1c1
Sequence:CCGGGCCTATCATTGTGGTTATTCTCTCGAGAGAATAACCACAATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-429s1c1
Sequence:CCGGCCCGCAGTGTTTGTGTATAAACTCGAGTTTATACACAAACACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2401s1c1
Sequence:CCGGCCTGGGATGAAGATGAATGAACTCGAGTTCATTCATCTTCATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007049.2-894s1c1
Sequence:CCGGCAGAAGAAAGAAAGTGTCATTCTCGAGAATGACACTTTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2055s1c1
Sequence:CCGGGCCAAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-328s21c1
Sequence:CCGGTCTTGGCCACGGTTGGAGAAACTCGAGTTTCTCCAACCGTGGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-1523s21c1
Sequence:CCGGTGATAGGATTCTCCCTTTGAACTCGAGTTCAAAGGGAGAATCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007049.2-2103s21c1
Sequence:CCGGACATCAGGGTGACCACATTAACTCGAGTTAATGTGGTCACCCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007049
BTN2A1 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 2, member A1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-965s1c1
Sequence:CCGGGCCTATCATTGTGGTTATTCTCTCGAGAGAATAACCACAATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-429s1c1
Sequence:CCGGCCCGCAGTGTTTGTGTATAAACTCGAGTTTATACACAAACACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2401s1c1
Sequence:CCGGCCTGGGATGAAGATGAATGAACTCGAGTTCATTCATCTTCATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007049.2-894s1c1
Sequence:CCGGCAGAAGAAAGAAAGTGTCATTCTCGAGAATGACACTTTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2055s1c1
Sequence:CCGGGCCAAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-328s21c1
Sequence:CCGGTCTTGGCCACGGTTGGAGAAACTCGAGTTTCTCCAACCGTGGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-1523s21c1
Sequence:CCGGTGATAGGATTCTCCCTTTGAACTCGAGTTCAAAGGGAGAATCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007049.2-2103s21c1
Sequence:CCGGACATCAGGGTGACCACATTAACTCGAGTTAATGTGGTCACCCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007049
BTN2A1 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 2, member A1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-965s1c1
Sequence:CCGGGCCTATCATTGTGGTTATTCTCTCGAGAGAATAACCACAATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007049.2-429s1c1
Sequence:CCGGCCCGCAGTGTTTGTGTATAAACTCGAGTTTATACACAAACACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2401s1c1
Sequence:CCGGCCTGGGATGAAGATGAATGAACTCGAGTTCATTCATCTTCATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007049.2-894s1c1
Sequence:CCGGCAGAAGAAAGAAAGTGTCATTCTCGAGAATGACACTTTCTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007049.2-2055s1c1
Sequence:CCGGGCCAAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-328s21c1
Sequence:CCGGTCTTGGCCACGGTTGGAGAAACTCGAGTTTCTCCAACCGTGGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007049.2-1523s21c1
Sequence:CCGGTGATAGGATTCTCCCTTTGAACTCGAGTTCAAAGGGAGAATCCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007049.2-2103s21c1
Sequence:CCGGACATCAGGGTGACCACATTAACTCGAGTTAATGTGGTCACCCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks