EMAIL THIS PAGE TO A FRIEND

BTN2A2

butyrophilin, subfamily 2, member A2

120 Gene Product Result for
Synonyms: BT2.2 BTF2
UniProtKB ID: Q8WVV5, A6NM84, B4DE97, B4DQ01, E9PH07, O00480
Gene ID:
Human(10385) Summary: Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(238555) butyrophilin, subfamily 2, member A2
Rat(306957) butyrophilin, subfamily 2, member A2
Domestic Rabbit(100348076) butyrophilin, subfamily 2, member A2
Horse(100065830) butyrophilin, subfamily 2, member A2
dog(488281) butyrophilin, subfamily 2, member A2
dog(100855640) butyrophilin, subfamily 2, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006995 Rosetta Predictions human pricing
NM_181531 Rosetta Predictions human pricing
XM_001072372 Rosetta Predictions rat pricing
XM_225366 Rosetta Predictions rat pricing
NM_175938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015029 predicted 925
2 SASI_Hs02_00342745 predicted 1683
3 SASI_Hs01_00015030 predicted 1825
4 SASI_Hs01_00015031 predicted 936
5 SASI_Hs01_00015032 predicted 976
6 SASI_Hs01_00015033 predicted 1183
7 SASI_Hs01_00015034 predicted 1819
8 SASI_Hs01_00015035 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095498 predicted 576
2 SASI_Hs02_00370147 predicted 1329
3 SASI_Hs01_00095499 predicted 1484
4 SASI_Hs01_00095500 predicted 590
5 SASI_Hs01_00095501 predicted 631
6 SASI_Hs01_00095502 predicted 843
7 SASI_Hs01_00095503 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338892 predicted 1628
2 SASI_Rn02_00338893 predicted 613
3 SASI_Rn02_00338894 predicted 1295
4 SASI_Rn02_00338895 predicted 1241
5 SASI_Rn02_00338896 predicted 549
6 SASI_Rn02_00338897 predicted 1417
7 SASI_Rn02_00338898 predicted 1937
8 SASI_Rn02_00338899 predicted 354
9 SASI_Rn02_00338900 predicted 1609
10 SASI_Rn02_00338901 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382773 predicted 270
2 SASI_Rn02_00382774 predicted 275
3 SASI_Rn02_00382775 predicted 278
4 SASI_Rn02_00382776 predicted 299
5 SASI_Rn02_00382777 predicted 294
6 SASI_Rn02_00382778 predicted 271
7 SASI_Rn02_00382779 predicted 1631
8 SASI_Rn02_00382780 predicted 612
9 SASI_Rn02_00382781 predicted 1302
10 SASI_Rn02_00382782 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091861 predicted 266
2 SASI_Mm01_00091863 predicted 392
3 SASI_Mm02_00346696 predicted 1581
4 SASI_Mm01_00091864 predicted 1911
5 SASI_Mm01_00091865 predicted 596
6 SASI_Mm01_00091867 predicted 1065
7 SASI_Mm02_00346697 predicted 1605
8 SASI_Mm01_00091869 predicted 1341
9 SASI_Mm01_00091870 predicted 659
10 SASI_Mm02_00346698 predicted 949
11 SASI_Mm01_00091862 predicted 1484
12 SASI_Mm01_00091866 predicted 1611
13 SASI_Mm01_00091868 predicted 1461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181531
BTN2A2 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 2, member A2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181531.1-319s21c1
Sequence:CCGGAGGAGGTTTCCATCGCTGATGCTCGAGCATCAGCGATGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1625s21c1
Sequence:CCGGATAACCACATTAAGCCCAATACTCGAGTATTGGGCTTAATGTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1324s21c1
Sequence:CCGGGACTCACAGCCATGCAGATAACTCGAGTTATCTGCATGGCTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1086s1c1
Sequence:CCGGCTGGACTATGAAGCTGGAGATCTCGAGATCTCCAGCTTCATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1187s1c1
Sequence:CCGGCTTCAGGTTAGGGTCTGATGACTCGAGTCATCAGACCCTAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-377s1c1
Sequence:CCGGCAGAGACAAGTATGTGAGGAACTCGAGTTCCTCACATACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2098s1c1
Sequence:CCGGGCTTCAAACTTCCTGATCTAACTCGAGTTAGATCAGGAAGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-660s1c1
Sequence:CCGGGAAATTGCACAGCAACTTCAACTCGAGTTGAAGTTGCTGTGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-589s1c1
Sequence:CCGGGTTGCATCAAGAAACTTCAAACTCGAGTTTGAAGTTTCTTGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2297s1c1
Sequence:CCGGGCAATCTATTGTGTCCAAATACTCGAGTATTTGGACACAATAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181531.1-3041s1c1
Sequence:CCGGGCGATTTCTTAGCCTCCATAACTCGAGTTATGGAGGCTAAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-198s1c1
Sequence:CCGGCTCATTGAAATCAAGGCCCAACTCGAGTTGGGCCTTGATTTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-992s1c1
Sequence:CCGGGACCCTGGAGATGTTTGGAAACTCGAGTTTCCAAACATCTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181531
BTN2A2 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 2, member A2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181531.1-319s21c1
Sequence:CCGGAGGAGGTTTCCATCGCTGATGCTCGAGCATCAGCGATGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1625s21c1
Sequence:CCGGATAACCACATTAAGCCCAATACTCGAGTATTGGGCTTAATGTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1324s21c1
Sequence:CCGGGACTCACAGCCATGCAGATAACTCGAGTTATCTGCATGGCTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1086s1c1
Sequence:CCGGCTGGACTATGAAGCTGGAGATCTCGAGATCTCCAGCTTCATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1187s1c1
Sequence:CCGGCTTCAGGTTAGGGTCTGATGACTCGAGTCATCAGACCCTAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-377s1c1
Sequence:CCGGCAGAGACAAGTATGTGAGGAACTCGAGTTCCTCACATACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2098s1c1
Sequence:CCGGGCTTCAAACTTCCTGATCTAACTCGAGTTAGATCAGGAAGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-660s1c1
Sequence:CCGGGAAATTGCACAGCAACTTCAACTCGAGTTGAAGTTGCTGTGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-589s1c1
Sequence:CCGGGTTGCATCAAGAAACTTCAAACTCGAGTTTGAAGTTTCTTGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2297s1c1
Sequence:CCGGGCAATCTATTGTGTCCAAATACTCGAGTATTTGGACACAATAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181531.1-3041s1c1
Sequence:CCGGGCGATTTCTTAGCCTCCATAACTCGAGTTATGGAGGCTAAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-198s1c1
Sequence:CCGGCTCATTGAAATCAAGGCCCAACTCGAGTTGGGCCTTGATTTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-992s1c1
Sequence:CCGGGACCCTGGAGATGTTTGGAAACTCGAGTTTCCAAACATCTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181531
BTN2A2 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 2, member A2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181531.1-319s21c1
Sequence:CCGGAGGAGGTTTCCATCGCTGATGCTCGAGCATCAGCGATGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1625s21c1
Sequence:CCGGATAACCACATTAAGCCCAATACTCGAGTATTGGGCTTAATGTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181531.1-1324s21c1
Sequence:CCGGGACTCACAGCCATGCAGATAACTCGAGTTATCTGCATGGCTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1086s1c1
Sequence:CCGGCTGGACTATGAAGCTGGAGATCTCGAGATCTCCAGCTTCATAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-1187s1c1
Sequence:CCGGCTTCAGGTTAGGGTCTGATGACTCGAGTCATCAGACCCTAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-377s1c1
Sequence:CCGGCAGAGACAAGTATGTGAGGAACTCGAGTTCCTCACATACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2098s1c1
Sequence:CCGGGCTTCAAACTTCCTGATCTAACTCGAGTTAGATCAGGAAGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-660s1c1
Sequence:CCGGGAAATTGCACAGCAACTTCAACTCGAGTTGAAGTTGCTGTGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181531.1-589s1c1
Sequence:CCGGGTTGCATCAAGAAACTTCAAACTCGAGTTTGAAGTTTCTTGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181531.1-2297s1c1
Sequence:CCGGGCAATCTATTGTGTCCAAATACTCGAGTATTTGGACACAATAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181531.1-3041s1c1
Sequence:CCGGGCGATTTCTTAGCCTCCATAACTCGAGTTATGGAGGCTAAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-198s1c1
Sequence:CCGGCTCATTGAAATCAAGGCCCAACTCGAGTTGGGCCTTGATTTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181531.1-992s1c1
Sequence:CCGGGACCCTGGAGATGTTTGGAAACTCGAGTTTCCAAACATCTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175938
BTN2A2 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 2, member A2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175938.3-2212s1c1
Sequence:CCGGGAGCTAATGGTCCATTGATATCTCGAGATATCAATGGACCATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1526s1c1
Sequence:CCGGCCCTTCTTTAGGCTTGGTTCTCTCGAGAGAACCAAGCCTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-592s1c1
Sequence:CCGGCAATGTCACAGCCTATGACAACTCGAGTTGTCATAGGCTGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175938.2-1853s1c1
Sequence:CCGGCCTGAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1637s1c1
Sequence:CCGGCCAATTTCTCAGAGCCTTGTACTCGAGTACAAGGCTCTGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1016s1c1
Sequence:CCGGCTGCCTGTAGTAATGCTGATTCTCGAGAATCAGCATTACTACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1248s1c1
Sequence:CCGGGAAGTGTAATACGAGGCTCTTCTCGAGAAGAGCCTCGTATTACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1382s1c1
Sequence:CCGGGAGATGTTTGGAAGCCAGTATCTCGAGATACTGGCTTCCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-794s1c1
Sequence:CCGGCCCTATGATGAAGTTGTACCTCTCGAGAGGTACAACTTCATCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-575s1c1
Sequence:CCGGGTTGCGCTCATTATCCACAATCTCGAGATTGTGGATAATGAGCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175938
BTN2A2 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 2, member A2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175938.3-2212s1c1
Sequence:CCGGGAGCTAATGGTCCATTGATATCTCGAGATATCAATGGACCATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1526s1c1
Sequence:CCGGCCCTTCTTTAGGCTTGGTTCTCTCGAGAGAACCAAGCCTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-592s1c1
Sequence:CCGGCAATGTCACAGCCTATGACAACTCGAGTTGTCATAGGCTGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175938.2-1853s1c1
Sequence:CCGGCCTGAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1637s1c1
Sequence:CCGGCCAATTTCTCAGAGCCTTGTACTCGAGTACAAGGCTCTGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1016s1c1
Sequence:CCGGCTGCCTGTAGTAATGCTGATTCTCGAGAATCAGCATTACTACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1248s1c1
Sequence:CCGGGAAGTGTAATACGAGGCTCTTCTCGAGAAGAGCCTCGTATTACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1382s1c1
Sequence:CCGGGAGATGTTTGGAAGCCAGTATCTCGAGATACTGGCTTCCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-794s1c1
Sequence:CCGGCCCTATGATGAAGTTGTACCTCTCGAGAGGTACAACTTCATCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-575s1c1
Sequence:CCGGGTTGCGCTCATTATCCACAATCTCGAGATTGTGGATAATGAGCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175938
BTN2A2 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 2, member A2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175938.3-2212s1c1
Sequence:CCGGGAGCTAATGGTCCATTGATATCTCGAGATATCAATGGACCATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1526s1c1
Sequence:CCGGCCCTTCTTTAGGCTTGGTTCTCTCGAGAGAACCAAGCCTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-592s1c1
Sequence:CCGGCAATGTCACAGCCTATGACAACTCGAGTTGTCATAGGCTGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175938.2-1853s1c1
Sequence:CCGGCCTGAGAAGAAAGTGTGAGAACTCGAGTTCTCACACTTTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1637s1c1
Sequence:CCGGCCAATTTCTCAGAGCCTTGTACTCGAGTACAAGGCTCTGAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1016s1c1
Sequence:CCGGCTGCCTGTAGTAATGCTGATTCTCGAGAATCAGCATTACTACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-1248s1c1
Sequence:CCGGGAAGTGTAATACGAGGCTCTTCTCGAGAAGAGCCTCGTATTACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-1382s1c1
Sequence:CCGGGAGATGTTTGGAAGCCAGTATCTCGAGATACTGGCTTCCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175938.2-794s1c1
Sequence:CCGGCCCTATGATGAAGTTGTACCTCTCGAGAGGTACAACTTCATCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175938.2-575s1c1
Sequence:CCGGGTTGCGCTCATTATCCACAATCTCGAGATTGTGGATAATGAGCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks