EMAIL THIS PAGE TO A FRIEND

BTN2A3P

butyrophilin, subfamily 2, member A3, pseudogene

Synonyms: BTN2A3
Species: Human BTN2A3P(54718)
UniProtKB ID: Q96KV6, A6NEF4
Gene ID:
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024018 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024018 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023533 predicted 1378
2 SASI_Hs01_00023534 predicted 331
3 SASI_Hs01_00023536 predicted 352
4 SASI_Hs01_00023537 predicted 1105
5 SASI_Hs01_00023538 predicted 1434
6 SASI_Hs01_00023539 predicted 1123
7 SASI_Hs01_00023540 predicted 1056
8 SASI_Hs01_00023541 predicted 1134
9 SASI_Hs01_00023542 predicted 1512
10 SASI_Hs02_00356444 predicted 1494
11 SASI_Hs01_00023535 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024018
BTN2A3P MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 2, member A3, pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1390s1c1
Sequence:CCGGCAAATCTTAATCTGCTCTGCACTCGAGTGCAGAGCAGATTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1115s1c1
Sequence:CCGGGAGACAATGTTGAGAGGAAATCTCGAGATTTCCTCTCAACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-1309s21c1
Sequence:CCGGAGATCACACATCTACACATTTCTCGAGAAATGTGTAGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-745s21c1
Sequence:CCGGCTGCCTGTTATCATGATTATTCTCGAGAATAATCATGATAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-333s21c1
Sequence:CCGGCAATGTCACAGCCGAGGATAACTCGAGTTATCCTCGGCTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-641s21c1
Sequence:CCGGACGTGTCCTGCTCTATCAATGCTCGAGCATTGATAGAGCAGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024018
BTN2A3P MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 2, member A3, pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1390s1c1
Sequence:CCGGCAAATCTTAATCTGCTCTGCACTCGAGTGCAGAGCAGATTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1115s1c1
Sequence:CCGGGAGACAATGTTGAGAGGAAATCTCGAGATTTCCTCTCAACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-1309s21c1
Sequence:CCGGAGATCACACATCTACACATTTCTCGAGAAATGTGTAGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-745s21c1
Sequence:CCGGCTGCCTGTTATCATGATTATTCTCGAGAATAATCATGATAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-333s21c1
Sequence:CCGGCAATGTCACAGCCGAGGATAACTCGAGTTATCCTCGGCTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-641s21c1
Sequence:CCGGACGTGTCCTGCTCTATCAATGCTCGAGCATTGATAGAGCAGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024018
BTN2A3P MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 2, member A3, pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1390s1c1
Sequence:CCGGCAAATCTTAATCTGCTCTGCACTCGAGTGCAGAGCAGATTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024018.1-1115s1c1
Sequence:CCGGGAGACAATGTTGAGAGGAAATCTCGAGATTTCCTCTCAACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-1309s21c1
Sequence:CCGGAGATCACACATCTACACATTTCTCGAGAAATGTGTAGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-745s21c1
Sequence:CCGGCTGCCTGTTATCATGATTATTCTCGAGAATAATCATGATAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-333s21c1
Sequence:CCGGCAATGTCACAGCCGAGGATAACTCGAGTTATCCTCGGCTGTGACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024018.1-641s21c1
Sequence:CCGGACGTGTCCTGCTCTATCAATGCTCGAGCATTGATAGAGCAGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks