EMAIL THIS PAGE TO A FRIEND

BTN3A1

butyrophilin, subfamily 3, member A1

17 Gene Product Result for
Synonyms: BT3.1 BTF5 CD277
Species: Human BTN3A1(11119)
Gene ID:
Human(11119) Summary: The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A1) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007048 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112931 MISSION® esiRNA esiRNA human BTN3A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007048 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229958 predicted 1321
2 SASI_Hs01_00229959 predicted 1471
3 SASI_Hs01_00229960 predicted 1320
4 SASI_Hs01_00229961 predicted 1224
5 SASI_Hs01_00229962 predicted 1671
6 SASI_Hs01_00229963 predicted 1278
7 SASI_Hs01_00229964 predicted 1777
8 SASI_Hs01_00229965 predicted 1237
9 SASI_Hs01_00229966 predicted 785
10 SASI_Hs01_00229967 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007048
BTN3A1 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 3, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-374s1c1
Sequence:CCGGCCTTCTGCTCAACTTTCGTGTCTCGAGACACGAAAGTTGAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1773s1c1
Sequence:CCGGGCTGTGGATGGATCGCATATTCTCGAGAATATGCGATCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1582s1c1
Sequence:CCGGGCAGTAAGAATGTGCAGAGAACTCGAGTTCTCTGCACATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1315s1c1
Sequence:CCGGGAGAGAGACATTCAGCCTATACTCGAGTATAGGCTGAATGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2051s1c1
Sequence:CCGGGCAACCAATCACAACCATAAACTCGAGTTTATGGTTGTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1234s1c1
Sequence:CCGGGCACAATGAAGCAAGAACAAACTCGAGTTTGTTCTTGCTTCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1583s1c1
Sequence:CCGGCAGTAAGAATGTGCAGAGAAACTCGAGTTTCTCTGCACATTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1776s1c1
Sequence:CCGGGTGGATGGATCGCATATTCATCTCGAGATGAATATGCGATCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2790s1c1
Sequence:CCGGGCCTTCCTTCAATCAAGGTTTCTCGAGAAACCTTGATTGAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2827s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007048
BTN3A1 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 3, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-374s1c1
Sequence:CCGGCCTTCTGCTCAACTTTCGTGTCTCGAGACACGAAAGTTGAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1773s1c1
Sequence:CCGGGCTGTGGATGGATCGCATATTCTCGAGAATATGCGATCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1582s1c1
Sequence:CCGGGCAGTAAGAATGTGCAGAGAACTCGAGTTCTCTGCACATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1315s1c1
Sequence:CCGGGAGAGAGACATTCAGCCTATACTCGAGTATAGGCTGAATGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2051s1c1
Sequence:CCGGGCAACCAATCACAACCATAAACTCGAGTTTATGGTTGTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1234s1c1
Sequence:CCGGGCACAATGAAGCAAGAACAAACTCGAGTTTGTTCTTGCTTCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1583s1c1
Sequence:CCGGCAGTAAGAATGTGCAGAGAAACTCGAGTTTCTCTGCACATTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1776s1c1
Sequence:CCGGGTGGATGGATCGCATATTCATCTCGAGATGAATATGCGATCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2790s1c1
Sequence:CCGGGCCTTCCTTCAATCAAGGTTTCTCGAGAAACCTTGATTGAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2827s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007048
BTN3A1 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 3, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-374s1c1
Sequence:CCGGCCTTCTGCTCAACTTTCGTGTCTCGAGACACGAAAGTTGAGCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1773s1c1
Sequence:CCGGGCTGTGGATGGATCGCATATTCTCGAGAATATGCGATCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1582s1c1
Sequence:CCGGGCAGTAAGAATGTGCAGAGAACTCGAGTTCTCTGCACATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1315s1c1
Sequence:CCGGGAGAGAGACATTCAGCCTATACTCGAGTATAGGCTGAATGTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2051s1c1
Sequence:CCGGGCAACCAATCACAACCATAAACTCGAGTTTATGGTTGTGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1234s1c1
Sequence:CCGGGCACAATGAAGCAAGAACAAACTCGAGTTTGTTCTTGCTTCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1583s1c1
Sequence:CCGGCAGTAAGAATGTGCAGAGAAACTCGAGTTTCTCTGCACATTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007048.3-1776s1c1
Sequence:CCGGGTGGATGGATCGCATATTCATCTCGAGATGAATATGCGATCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2790s1c1
Sequence:CCGGGCCTTCCTTCAATCAAGGTTTCTCGAGAAACCTTGATTGAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007048.3-2827s1c1
Sequence:CCGGCCCTAGAGATTCTCTGTGATACTCGAGTATCACAGAGAATCTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks