EMAIL THIS PAGE TO A FRIEND

BTN3A2

butyrophilin, subfamily 3, member A2

52 Gene Product Result for
Synonyms: BT3.2 BTF4 CD277
Gene ID:
Human(11118) Summary: This gene encodes a member of the immunoglobulin superfamily, which resides in the juxta-telomeric region of the major histocompatability class 1 locus and is clustered with the other family members on chromosome 6. The encoded protein may be involved in the adaptive immune response. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Rat(294268) butyrophilin, subfamily 3, member A2
chicken(101668632) butyrophilin, subfamily 3, member A2
chicken(101752091) butyrophilin, subfamily 3, member A2
cow(615223) butyrophilin, subfamily 3, member A2
dog(481727) butyrophilin-like protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007047 Rosetta Predictions human pricing
XM_001077286 Rosetta Predictions rat pricing
XM_215321 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152593 predicted 775
2 SASI_Hs01_00152594 predicted 1065
3 SASI_Hs01_00152595 predicted 1137
4 SASI_Hs01_00152596 predicted 697
5 SASI_Hs01_00152597 predicted 1075
6 SASI_Hs01_00152598 predicted 1086
7 SASI_Hs01_00152599 predicted 1277
8 SASI_Hs01_00152600 predicted 1219
9 SASI_Hs01_00152601 predicted 1312
10 SASI_Hs01_00152602 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356540 predicted 1024
2 SASI_Rn02_00356541 predicted 789
3 SASI_Rn02_00356542 predicted 907
4 SASI_Rn02_00356543 predicted 1060
5 SASI_Rn02_00356544 predicted 769
6 SASI_Rn02_00356545 predicted 800
7 SASI_Rn02_00356546 predicted 1063
8 SASI_Rn02_00356547 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375905 predicted 1043
2 SASI_Rn02_00375906 predicted 1043
3 SASI_Rn02_00375907 predicted 835
4 SASI_Rn02_00375908 predicted 810
5 SASI_Rn02_00375909 predicted 1052
6 SASI_Rn02_00375910 predicted 846
7 SASI_Rn02_00375911 predicted 950
8 SASI_Rn02_00375912 predicted 879
9 SASI_Rn02_00375913 predicted 1115
10 SASI_Rn02_00375914 predicted 33
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007047
BTN3A2 MISSION shRNA Bacterial Glycerol Stock
butyrophilin, subfamily 3, member A2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1149s1c1
Sequence:CCGGGCGGGAAATAAGCCTAAGAGACTCGAGTCTCTTAGGCTTATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-480s1c1
Sequence:CCGGGAACGTGTATGCAGATGGAAACTCGAGTTTCCATCTGCATACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1048s1c1
Sequence:CCGGGCCAGTTACTTCTTGTGGAGACTCGAGTCTCCACAAGAAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-705s1c1
Sequence:CCGGCGTCGAAGTGAAGGGTTATGACTCGAGTCATAACCCTTCACTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1235s1c1
Sequence:CCGGCCGATACCAATAAGTCAGCCTCTCGAGAGGCTGACTTATTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1097s21c1
Sequence:CCGGAGATAGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1073s21c1
Sequence:CCGGAGGAAATAACTGCTCTGTCCACTCGAGTGGACAGAGCAGTTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-850s21c1
Sequence:CCGCCTATATGAAGTAGCAGCATCTCTCGAGAGATGCTGCTACTTCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007047
BTN3A2 MISSION shRNA shRNA Plasmid DNA
butyrophilin, subfamily 3, member A2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1149s1c1
Sequence:CCGGGCGGGAAATAAGCCTAAGAGACTCGAGTCTCTTAGGCTTATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-480s1c1
Sequence:CCGGGAACGTGTATGCAGATGGAAACTCGAGTTTCCATCTGCATACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1048s1c1
Sequence:CCGGGCCAGTTACTTCTTGTGGAGACTCGAGTCTCCACAAGAAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-705s1c1
Sequence:CCGGCGTCGAAGTGAAGGGTTATGACTCGAGTCATAACCCTTCACTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1235s1c1
Sequence:CCGGCCGATACCAATAAGTCAGCCTCTCGAGAGGCTGACTTATTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1097s21c1
Sequence:CCGGAGATAGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1073s21c1
Sequence:CCGGAGGAAATAACTGCTCTGTCCACTCGAGTGGACAGAGCAGTTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-850s21c1
Sequence:CCGCCTATATGAAGTAGCAGCATCTCTCGAGAGATGCTGCTACTTCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007047
BTN3A2 MISSION shRNA Lentiviral Transduction Particles
butyrophilin, subfamily 3, member A2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1149s1c1
Sequence:CCGGGCGGGAAATAAGCCTAAGAGACTCGAGTCTCTTAGGCTTATTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-480s1c1
Sequence:CCGGGAACGTGTATGCAGATGGAAACTCGAGTTTCCATCTGCATACACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1048s1c1
Sequence:CCGGGCCAGTTACTTCTTGTGGAGACTCGAGTCTCCACAAGAAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-705s1c1
Sequence:CCGGCGTCGAAGTGAAGGGTTATGACTCGAGTCATAACCCTTCACTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007047.2-1235s1c1
Sequence:CCGGCCGATACCAATAAGTCAGCCTCTCGAGAGGCTGACTTATTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1097s21c1
Sequence:CCGGAGATAGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-1073s21c1
Sequence:CCGGAGGAAATAACTGCTCTGTCCACTCGAGTGGACAGAGCAGTTATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007047.3-850s21c1
Sequence:CCGCCTATATGAAGTAGCAGCATCTCTCGAGAGATGCTGCTACTTCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks